Description :
From Genome Similarity Track
Location :
scaffold_66:56294- 70696
Transcript NameFunction/comments
Pl_110636hypothetical protein PHYSODRAFT_294946
Pl_110637hypothetical protein PITG_02639
Pl_110638unnamed protein product
Pl_110639hypothetical protein PHYSODRAFT_349437
Pl_110640hypothetical protein PHYSODRAFT_323484
Pl_110641hypothetical protein PHYSODRAFT_294941
Pl_110642hypothetical protein PHYSODRAFT_294940
Pl_110643hypothetical protein PHYSODRAFT_294939

Sequence
14402 bases(100 bases per row)
GGAGTAACGGCTATTGTTGAGACTTTATGACTAGCTAATTATCAGGGAAGTCGTTGTGAAGAAGTGATGACGTTGGATGGGACGTTAGATGAGGTGGAGG
AGGCGCTAACGAGTTTGAATAGAAAAGCATGTGTGGTGTGGCCTGCTACTGCTGCTGGAGATTTTGTAGGTGCCTTCCAAGTGTTGACAGAGAAGGAGTG
GCAAAGACTGCAGCGAGATGGGCTAAGATTGGCGCCTGGTGTCGATGTGAGAGATCTGTACTGCTTCCAGAACGTACCGGCATACGACGGACTGACGATA
CGAGTGTATCGGTTGGTTCAAGAGTCTCAAATCCACACGAGGCAAAATGAATGGGAAGTCTGGAAGGTGCAGAAAATGCCTGTGATGATCAGAACGAGAG
CACAACTAGAAAATCAATTTGTGATTGCGAGGAATGGAAGAGAGATCTTACGCAGCAATTCAAGTGCAGAGGACACACCACCTCAATCAGTAAATGTTGT
CAGACTCGAGACCATTTCCCCAGAGGAAGTAAAGAGAAAGAAACGTCGGAGCGCTGATGTTGGGAATTTAGAGGGTTCGAAGTGTGTTGTTGACGACGTC
CGCCCGCCGACGAAGACGCGCCGTCTGGATGACAGTAGTAAGGAAATAAGTACAACTGCTGATCCGATCGTGTTGCCAGAAATCCATACAAGGGTTGCGA
GTCGTGACACTTCACGACACGCCGCTAGGACGCATCGCAACAATACCATTGACGAAACCACGGGGTTAATTCCTGTGGTTGAGGGTAGTAATTCATCTGG
GTATTCGTCTGAGGCAGTCGACAACGAGGGCAATACTATATCTGAAAATTCAGATGGAGTGCAGAGCGACGAAGAGATTCTCGAGCAAGACTCAACAGCA
GTATCTTCTCCAATAAGGCGAACCGAGACTCGCTCTGGGCGAAATGATCGCCGTAAGCAGGAGACTTTAAATTTGGCGTTGCAGAGAGTTATTGCAGCTG
GTATGTGCATTGATGACGAAGATCGCGGGAATTGTACGTCGCACAGTCGAGCTCAATCGAGCAGCGTCACGAATTTGTTTGAACCACTCTGGTCCATTTG
GGAGAGTGCAACGACACAAGTCCACAATGTGCTGAACAAAGTCTGCGCTTTGTCTTCGAACATTGATGTTATCACAGCCCAGGATTCGATGGACTACGAT
TTACTTTGGGTTGAAGAGGGTGGTGACCAACAACGCTGGACAATGTTTGGTGAGCCGAGCACTTCAGGTCCGATAGGTGAAAACTAGGTTTTAGCAACTT
GATCAAAGTGGCAACTAAAGATAGAGAAATTCTTATGCGGGTGATACAAACCACTCCCTTCTTCTCTATCTGGACATTCATTTCCTTGGTGACATGGCCG
ATATATTCACCAAAGAAGTTTCGAGCACAACCCACAATGGCACCAATGAACTGAGTGATGAAGCCCAGTGTGATGCACTTTTGAATGATTTTCATGAAAG
TCAGCTAACTCGTGGCCGCCCAACCTCAGGATCAGTAACTAAAACGTTTGCCACTCCTGGTTTTCTCGAGTGTGACTGTGTTACTGCAGCAAAGAGAGGT
CGATATGATGAGATAGTGTGCAATGCCCACAAATTAACTGTACGAAACTCACGACCACATCTCGAGTCGATTGAATTCTCCCAGAAAATGGCTTCGCTTG
CAGAACAAAACTCTCCACTCTTGAAGTCAATGACATTGCTGCCTTCTTCATCAAGACATTCTGCAGTTGGATCCTCCACTGAAGACCTCGATTCCGTCCT
ACTAAGAGCATCCAAGAGCACGAGCTCCTTGCGACACCAGCATAATTTTACCACCGAACTAAGCCTTTCGCTGTTACCTTCCCTATATTCAAAGAGCACG
ACACCGCTCCGCACAGAGAGCGGCATTCTCGAAAATTCTACTGACCGCAAAACCTTCTTGCTTTCGTCGCTAGCACTGGATGCACCAACGACACTGTCGC
TGCAGGAAGCTCAGAAAATGCTCGAGTTGTACAACAAGATCATCCGCTTGAACACGGAAACTAAAAAAAATATGGGGATCTTGTACACACGGCGATCCAC
ACTCTTGGCAGCAATAGGAAAGTTTTCAGCGGCGCTGTACGATGCAGAACAGGTTGTGCTTCTGGACCCAAAGTCGACCGTAGTACGTAAATTTGTTTGC
TGATGATGTTCATTTATCTGTGTACTAGCTCATTTGTTCGGGTACTGATGACTATTGCAGGGATATTATCGCAAAGGTTGCGCGCTGTGTGGACTTGGAA
GATTTGCTGAGGCAAGCCGAGCCTTCCAGCAAGGTCTGGCTTTTGACGTCAATTGTCGATATCTGCACCATGGACTTCAGCAAGCACTCAACCACTCGCG
GTACAGCCACTAGTCAAGGAAAAATAAAATATAAAACCATCATTGCAGAAATGGTCTAGCACAGATACGATTGATACGCCCATTGTGGCATTCGTAGCAC
TGGCAGCTTCTGTTCAAACTCCCTGTCTGTCAGGCGCTTATCGATCGGTGTCACAAATTCGTAGCTGCTAAACACTGGACCGGCGTGCATGACATTATCG
ACGACGAAAAATCCCATTAGTGGGTTGCCAGCACCAAAATGTAGCACCCCTCCTGGATCGCAGTGTTCGGTTGAGGGTGAATCCGTGTGAACGTCCGCCA
CGATCACGTCGCTTTTGCCAGAGTCGTCTCGGCTTTCGAAAAATAAACCGGGATACCATCCGCAGTATCTCGATCCTCCGCTTCCGAATCGCTCTTCCAT
TACAGTCTTCAAGAAGTTCACTTGATTGTCGTTTAACGGTTTGCGCTCAGCCTGAAAAACTGCAATCTCTTCAATCGACTGCATTGTTTCCGCAAAAGAA
CGAAAAAATCGTTGGGCTTTGCGCACGTAGCACTTCCCGCCAGAGTGAAGTGAGTCAAAAGAAGTCAAGTACACTTCTTTGACTGGTTGTGTGAAAACTC
GGCCAATGGGTCCACCACTCTCAGGATCATATTCTCCATCTGCATTGCAAGCTCCTTCATTCGCTTCCAGAAGAGAGGGTACGGGTCTACCATCCCATCG
GCGTACTCGCAGCCACACATCATCGTATAACTCTGCTTGGAGTAAAGCAAGGTATCATGGCGTAGCTGAGAGAACGACGCAAGCTGTGTATTCATTTTGT
GGTGTTGCCAGGATTGGGAGTGGAAGGTATCAGCAGCATTCGGCGACTCTCGTGACAGTTCACGAAGAGCTTTTTGCCATAGCATACTGATGATCGTACT
TTCGTCAACAGCATTTCCACTCTTGCTCTCTTCACTGTCAAATTCTTGATCGATAACTTGGCGAAGAGCAACAAGGTTTGACGAAAACTGGATTCCGTCT
CGGAAAGGAACAAACTCCTGAGAGTTCAATGAGGCTGAGTTTGGTGGATTGGTATTCATTCGATTTGCCAGAACTTGAGTAGCACTGTTATTGGCAAACA
GTGTGAAAGCGATGTCAACTGCACTTGGAATGCGTCGCTTCTGTTTTACATCGTTGTGGAGCACTTGGTCGAAGACCAGTCGCGAGAAAATGAATGCACT
CCAAACGAACCGCTGTCCAAGTAACGCAAAAGAAGTTGGTGGAGTCATAGGTACCGTCGAATTTAATGGCTCATTTTCCGTACGAGGGTGTCCATTAATC
AATTGATTCCCAAGTCCTTTTTGGAGAATCTGTTTCTGAATACCCTCCAAGATCTTTAGACGTTGATCATCATCATCTACCATTATGTCTTCGGTTGACA
GAAGTCGAGCAAGTTGCGTGGGCGAAAGCGAGTCCGATCCCATCCCACCATCAGCCACCAGACTGGAGATCAAGGAGTCAACACTCTCCACAACCTCCAA
AGTTTGAGCTTCGAGTAGGAATCGCACTAACAGAACAGCACAATGCAACTGGTGAATATCCTCGACACCATTGTCACCACCAGCTACACGAAAATCGACT
GTGCCAAGCCATGTTATGGCACGAAAGTACCGCATCAATTCTTCAGATTTTGTATAGTGACCGCGAGGCTTGAACTGCGAGAAATCAACGTCACGCTTTG
CAGAGAATATCTCTGTTGTAGTTGTTTCTTCTGAATGAATCATCTCAAGTAAGTGCTCCTGTTTGAGCGAGTTCTCAGAAGGACCGTCCAGTGTTTCACC
TTGTAAGAGACTTCGTGCCACTCGGAGAAATAACTCCACATCCATCATCGCTCTTATCTGGCTAGAGTCATCCTTTGGAGCACAAGAGATGGCGTCACAG
CATTTAGAGAGCGTAGATTCTAGGATTTTATCCAAAGTTTGAGATAGCACTTCTACTTCCAGTTCCACCAGAAAAGCGTCAAAACTGCGATGCCACGCGT
GTAAGATCGAATCGGCCGTCACGAAGACTGGCATGTCATCTGAATACAGCCGATAATAAATATCAGCAAAGCTCTCGGCCTGCATGCGTTCCGCCACAAC
GAATCCATTAGCAGCCAGTCTAGCTTTCTCGCTTGCTTTGAGTCGATAGTCAGTGGTTTGTATCTTTTTCAGTGGATGATGCGTTCCTGACATCATGATT
TGGTTCAAGTACGTAGATCCATGTTGCTTCTTCGCTTCTTCACGGAGACGCTCTGTTTCCTTACGAACTTTCACTGGATCTGCATCAAAAAGGTCAAAGT
ATTTACAATCTTCCAGCACGATAGACGCACGATCTTCCTTAGATTGTGCAGGGTACAGTTTCGTGAGGTCTTCAGCCGTCAAGTTCGCGCCGATCTTCTT
TAACGTCGCTGCAAATGCAGCCCCCACATCACCACCACCCATGCTTCTGTCCTTGGCCGCAAAATGTCGAGTGAGCCGCGAACCGACGTCCACTCCAAGC
TGGGTTCAAGATATCAACCCAGCGATGACACCCTTAAGTGCGCTGCATGTGCATCACGCTTGCAAATTGCATAAAGCACGATTGCGAAAGCATGGCACTC
GCTTGTCATTAGTTTATGACGACTAGAAGCATAAATTCACCCTTCAAACAGATAACAACACCACTACGCACCACTTTACCTAGAACTGCTGTTAGCAGAA
GGGCAGTCTATTAAACAATGAGCCTATTCAATCACGACCTCGATCCAGTGACCCTGACGCCGAATTGCTAAGGAGCGGTGGAAAACAGTTCCTAGATCTC
TTCCACACGGCCCGAGTAGTCTGCAAACATGTCGCTCTTTCCTTGTGCGCGTGCTTTTGCGTCAGCCTCTGAACACCAGAATCATGTGATGTTAGAAAAG
CAAATAGCATACACAACCAATCAAAAAGGCAGCTTACCGCTAGAACCTCTGCCCTGCGATGGATGAAATGAGTAGTGTGGCGGGTTCGAAGGTGTTTGTC
GCGACGGTCGATTTGGCGTCGGCGACGGCGGACGCACTGGCATCCGCTCAAACTCTTCCAGACCTTCAAACGGGCTCGAATCACCCCTACCCAACAAGCC
ACCACCAAAAAAGTCTGCAGCAGCAAACAATCAGTACCTTATTAACTCTCTCACAAACTATTACCACCCCTACCTTCAAACGGACGCAGCATTTCTTGTC
GGAGAAAGTCAAATGGACTCATCTGCGCTTCAAAATCGTCACCTCTGTATCAACAAGAACCTAAAGTCAACCAACCACCACTCATTTCCCCTTTTCTACA
TTTAATTCGCCAAATGCACAAACCGTTGTTGGAAAAATGTCCCGAATTCCTGTTCGCCACTGCATCATCACGGAATTTCACATGAGCACAAAATGACACA
CTCCTGATGTTTACATATTTAATTGGCACACACCCTTTGCGTGGATCCATCCTCTCTCTATTGAAAAAGTCTCCAGCGGTCGCTTCACCTCCGTGTTCGT
CCTCTGTGATCTCCTTGCGGTTCGAGATGAGCTCCTTGCGAGTGTTGGGACATTGGCGGAAAATCTTCTTGATGATCTCGCACTTGCTGTCGCCGTTGAT
GGATCTACAGGACTGCGACAAAGCTGTCGAGTAGAAACAGCCAGGATTCGCCTCCCGGTCCTTCTGGATCAGCTCCTGCTCCTCGTCACTCAGCGTTGGC
ATCTTCTACTCGTAATTTTGTGCCGTCTTCTGGAATAAAATGTTAGGTTGTGTGCACCACACAATTATACCATCATTCTGCAGTCGAGAACCTGGCAAAC
GGCATATAGAATGCAACTTCAACGACGTACATTCGCGATGAGTGCATGTCACTTTGTTGCTGTTAATTGCTTATTTAAGACTTATTTAAGATAGATAAGA
TTAACGTAGTGGGGTTGTTGACGTGAAGATGAACAATGGGGAGCAGGTTTCTGCTCATCTGGAGCTCATATTCTGCTCCAGCGAAGATGTGCGATTCCCT
GCGACGAATCTGACGCAGTCAGGTGATGTGCCGAATGCTGCTCTAGCTGTTTGGGAGTCGGAAAAGTTCTGTGAGTTTCCGCAAGAGCTGGTGTTTCGAG
TCAATCGAGGACTGCCGACATTCATCGAGCAGGTGAATCTCCTGTCGCACCCCTTTAAAGTGGCGACACGAGTGGAGATTTTTACGTCTTCTGCTGTGAG
CAACGGAATTCATGATGGTAAGACTGGAGTGAGATTTGAAAGGCTTGGGTTTGTGTGCTTTCAAAACAGCGAGAACACGCAGGTCACCGCATGTGAGCTT
CAAGAGGTGCAATTGCCTCCACCTACTTCTAAAGTCACTCTTTTGCGTCTGGTTTTGCATTCGTGCCATCAAACAAGAACCAACCTTTTCAGTCAAGTTG
GTTTGGCATCAGTCGTGGCGTTGGGACCTCAAAAATCCACCAGCATAATACTACCATTGATACAATCCCCCAAAAAGAGCCCTGTCAAAGAGAGTTTGTC
ACCCCGCAGTAGAATTCACAACCTTTATGACACAATCTCGTCCGGACCAAGTCAACAATGTGGAATAAAATCACCGCGTATAGCAGCTATCTCGACACAA
GATACTCAAGAACACAAGAAACCTGAGCAAATTTGCGCCGACATTCAGATCGGCAAGCAGCTAGCACAATTTGTCGATAATGATAAGGCTGTGCAACCAT
GGGTTTCTATGGAGCAGGAGGCCAATTGTTTGATGAATACGCTAGAATGCAAATCAAAGAAACAACAAGCTATGGTAATCTTAGGTGAAAAGGACGTAAT
TGCAAGTTTTACTGATCTAGAGCGCCGCAGAAAGCGCCAAGAAAAGGAGCTTTCCCAGCAAATGTTTTCTTCTCCGTCGGCGCGATCACCCAGCAACGGC
AACAATATACCACTAGTGCTTCGTGGACCGAGGGTACATGAAGTACTAAACCGATTCCAAACTAGTCAATGGCAAGAGAGGGAAACTTTATTGTGGCAGC
TTACAGAGTACTCAGCAAGTTTGATGGGAAACGGAGACTGTCGACTCGCAGTAACAGACGACAAAGTGCTTGAAATTCTAATTGCTGCACTAGACGACTC
AAATGCGAATGTGTTTGTTGCTGGGTGCGCATTTCTTCGAGCATTGCTAGGCTCGTTACCATATTTTCAAGATGCGGTCGCTTCAAAAGATGATGTTAGT
ATTTTGATTTTCGAGCTTTTAACTCCACCAACCGCTAACGTATGTTTGCTTATTAGCTTACTGAGATTGTGGATTGTCTTCTGGAGAGACTCGGTTCTCG
TGAGGCGTCCATACGCAATGCGGCTGCAGTTGCCATTTTGAAGGTACATAAAGGTTATCTTATCCTAATGTATCCCCTGTGATTTTGAAGAATTCACGTT
TGTTTGGGCCCATTTCTGTAGGTTGCTGGATCCACACGTACAAGAGGTACATTCGTGATGCACCTACTTTTAAAACACATCGAGTCCAAGCACTTTCAGC
CGTCAGACCAGCAACTTTTGGCGCTGTTGAAACTCGTGACAGCTCTACTATTATCATTTCATTGTTGTGCAAGTTTCGACATCGCTCCTCGGCGGATACT
TCGTTTTCTGTTGCTCAGTGATGCAGACCAACACGAGAACGCATTGATTCGCGAAGCTGCTAAACAATTGATCCTTGCCCTCTGTCATGACGTAGACGAA
GAGTTTGTGCTAAAAAATTATGTAAAAAAACTCCCACCCGAACAACAGCGACAGTATGATATCTTGATTCATCGGAAACGTGATGTGACTTCATAATTAC
CGAAGACAAAACATTAAACGTTTCCAGGTAACTCGTTATTGAAGTACGCAATTGTCGGAATCTTTACCATCCTTTTTGTTTTTGCCTTTGGTTGTCACCT
TGCTTATAGCCTTCTTATCACTTTTGCGATTGGGTTGGTTAGAACTGTTCAATGATTATATATCGTCAGGTTGCTTGAGCGTTTGTTCAATTGCTGATGT
AGTTGTAGCAGAGATGTGGTTTGGTACGTAAGACGCATGCTTAGCTGTAGACAGCATTTGGTCTGTTGTAGGCGTAGTCGGTATTTGACTTGAGGTCGCA
CTCTTTGGTACAGGTGTTGAGATTTTTTCGATACGAGCTGAGTTCTTTCGAGTAGGATTCCCGCTTAGAGGATTGATCACTGTGCTGTCAGGATAAGTGA
CATCCTGTTGCTTATATGAGGGAGTCACTCCAGCTGTTGGAGTTTGCTTTTGTTCCGGAGATACCCTGCTTGATCGTTTGGGTGAATCACTGCGCCGCTC
AACTGAGCCTCGAAAAACAGCAAAACTTGCCGTAATTTTGTCGGGACCTACCGTTGTTAACTTATTATCATCAATGTCGAACACAAACGGAGCCGACTTT
CGCTGGATTTCGTCGTGAAATGTTCCTTTCGGTGGTGTTCGAGCAACAACATGTCCTTGAAAAGAAATGTTACCCTTTTGAAATGACTCAGAGGAGCTCT
CGGCTGATCCATCGCTCTTGGAAGAGCTCGTATGTACAAAGGAATGTCGATAAAGAGCATTTGGACGAGGTTGACATGAAAAATATCGCTGCAGCTGTGT
CGTAAATTCTATCTCCTCGGCATTCAGAAGAGGTTCTTGAATGAATAGCGCACCGTGAGTGTAGCGATATGAACGATGACTATTGGGGTTTCTCGAGACG
TCAATTTGCTTGTGCAGGGAAGTCAATAGGTGTGTGTGCTTATGATCACTCAAAGTAGATCGGTCAATTTCAATTAAGCACTCCGAAGCCAGTCGTGTTG
TAATTGCGTCTAGGTTGTCATGACTTAACGTCACTTGGTCACTTTGTGGAACAGAATGTAATGACAAAAAGCTGGTGCAAAGTGTTCGAATGCTCGCTTT
CAGGTTTGGTGACGTCTGACATCGAATAATATCGTTCCGCAACACCAAACGAAGCAACCGGAAACGGTTCCTCGCAAATATGGTACCTACTGCATTGGCT
GCAGGAGTTAGGTCGATAAGCTCATTGAAAAAATTCCCACGAGTTAAATCTTGGTCAATCAGCAAACGAATAAACTGTAGGAAAACCCTATCGATTGATG
GTGGCACTTTTGAGGACCGTTCCGAGGGTTTAACATTGCGTGGACTTGTCTTGTATAACGTTGTTTTGGCGGTGTGGCTGACCAACCAGCAAAGCGGACT
TGCAAGTATCCACTCCAGGATAACTCGCAGACCGTAACTCCAATTAGCTCGGGCAATTTCCTCAATTAATCCAAGCACACATACGTTTTCATGATCGATG
GAGCTGTCATCCTTACATTTTGCTGTTTCAGTCAGGAACACAGTGTATGCTAGATGAATTGTTGCGTGGAATGCTTGAGATGACTTTGCCTCTCGAACAC
TAAGAATAATAAGCGCGATAATACCCTCGAATGATGGTATCGTACCAATTGTCTTTTTCACAACAGGAGCAACACGCTCAACCAACTGTACACAACTCAC
TTGAATCTCCGCTCCACCGCACAGTAAGCACTGCGTAAAGAATGATCCAAAGGTGTACAGCGTGATCTCGATGCTGTTGACTGGATCAAGGGGTGATATC
GTCGGGGACTGCCATGATGATACCTCGTCTCTCTGTGTACATATCTTCGAGGTAAGAATTTCCTCGAGCACATGCCTCTCTCGCGACATTTGTTCGACAT
ACTGTCGTAGCACATTGTCGAAAGGTGAGGCTGGTTCATTGTTTTCGATACTATTTTGTGATTCCAACGTCGGAAATTCTATATGGCTGATTTGGGAGTT
TGATGTTGGGGGCATTTTGCCAGCGTCACTAGAGCGCACCTTGCGTTCTGACTGCGAGTTAGACATATTTTCTTTGTGTTCGCAAATCGTTGTTACCTGA
GCTACAAGATCCATCGGTACTCCTGCGTCCAGCAGAACTGTTTGCAACTCGTCATTGTCACTGGCGAGAGGAAGCCACACGGGTCGATGAATGACTCCAG
AATTGGTAAACTCTTCGTACTGTTTGGTGCTAGACAGACTTGGATCCAACACATGAGCAACAGATTCACTAGATGACCCTAACAATTCAATATCCTCCAG
TACAATCTACGTCAAAATAGTGCTGTTAGCTAAGCACGCGTTTGTATCCTAAGCACAATCAGTACCTGTTGAGCCTGGTTGCTGTAAGGAGCGTGAACAA
TGAGTTTGAGAAAAGAGCAATCCGATACGTCCAGGTGAGCGATTCTGGAATCGGTATCTCGAAATGTGTCTAACCTCACAGAGGAACACACCTCCCACAC
CAAAGGTTCGCTGAAGAATCAATATCCGTCAAACGTTTTGAAGGTGAGGTAGAATTGCAGCTAACCTACCAACATTGTTTCCATTCAGAACTAAGATAAC
GAGATACAGCGTCCAGAGGATTTAGTTCGTTTACGATTCGGGGTGGTAAAGCTTCAAAAATGACAACTACAAGCAGCAATTAGAATTACAACTTGTATAT
GATTCAAGCTACCATGAATACTTGCTTTGACCTGGAGTCCGGGCAAGATCCGCTGTCACGCGCAGAGTCTTAGCCGTAGCAGGTTGAGCAGATAGTAGAA
TCAGCCCCAGCTCTTGTGGATATATAGTGTTGCTACATCAACAGGTTAGATAAACATCGAAACACCGAGCTGGCCTTCATGGCGCCTACAGTTTGGATTT
CCAGAGAGGTTGGTGTTCTAACTCCTCGATTACACCTGGTGGATGCCAGTTGAGTCGATTGCTTCGAGTCACATCTTGTAGATCCAAGTTACTCAGGACA
AGCAGTCGAAACGGAATACTGTGCATTCCACCAAGTCCACTGTCAAACGACGAGTCGCTAATAAAAAAATAGTCGTGTAGATAGGCGATCAAGATCATGT
TGGTAGAATCCAATCAAACAAGATCATGCACACTGCATTTTTTTCATACTGCATCAAGCATGATGTTAAACTCCGACTCCTTCGGCCACTGACGGATCGA
CATATTTACTTGAGCTCAGAGGCGCCAGTGAGGCATTTCATGTAAATATACGTGTCCACACCGTGGCCCTCCATTGGCATGATCGCCAGCTCACCGCCAA
AGTACTTGGCGTAGAGCTGAGCGATACGCAAACCGAACGAGTCCGAGAAGTCCAGTCCGCTAGCACGTCTCTCCAACACATCCGCGACGGGATCGTATCC
GTTCGAGGGCGGGGAAGTCGCCGTGTGGTAGTAGTTCGACAAATCATTGGCTTCGCTGCGGGTCATGCCGCCACCCAGGTCCGACACCTTAACGCATACA
CCATGAGGTCCACCGGAGATCAGTACCTTCACAGGTGGGGGTGACATAGCTCCTGTCCTCTTGGCTGCTGCGACGCTGTTCAACACAGCATTCTTGAACA
CCTCCGTAAGGATGATCTCAATATGCTGCGGAACGTAGCGGTACGTCGCATCTTCATCACCACTCACAATGATCTCGGGCAGTTGCTCGCCATTGAGACT
CTCCTGCCACAACGGGCGAACTTTGTGCACAATATCTTGTGCAATTTTCACAGGCGAGCACTCATTATTGACAATACCCGTAAATCCAAGCGTAGGTGTC
TGCGCCGCCACATGCTGATCCACCAGCATACGGATGCCAATACGAGAGTTGTAGAAGTTGTCCAGCGATTCGCTAAGACCTTGGGGTTCGTACTCTAGCG
CTTGTACCGCCTCTGCAATGTTGCCATGCATCGTGGCATGTTCCTTTCGGATTTTGCGATGCAGCTCCATAAATTCACTCTCGCTCGAGAGATTGGAGGG
CAGCGGAGAGCTCATGAGCTGGTCGAAGCTGCTGAGTAGCTGCTCACGCAATGACACAATAGAGTTGGCTTGAGGCAGCTCGTCCGGCAGGTTCTCAAGG
TCCACGATGCGTCGTGCAATGCGGATCGGCACTTCTCGATGCAGAAGTTGTGCAGACGTGACGATGGCGGGCGCGTTCACTTCGCGCCATTTGGCTAGCG
CCTGCGGGTCATTCTGCAGCGACGCGGCGATGGCGGGGCTGGCGCTGGGTCCGCGCTTAAGCAGCGCTTGCAGCGTGATAGGCGGCAGAGGGATGTGGTG
TAGGCGATACACCTCGGCCAACACTTTGACTCCTACAGATGTGGCCATGATGCAGATATTTGGAGAATGAGACTGAGGAGCTCCCCGTAGCATAAAAATA
TTATTCTTGTGGATCTGACAGATTGCGCAAACGTTTGACCAATAGGAAGGTCGGATTTGGACTTTTAGCCAATGATAGATGGCTGAAGTGAAACTTATGA
ACTAGCCAATCAGAAAATGCTAGTCAAGATACAATTGCTTGAGCTTTTACTTGACCTGCTGGGGTAGGAATGTTGCGTCGCCGTAGAATTGAGGCACGTA
CTTCAGTTTGTCTCTCGTTGCTAGATTGGCACCATTCTCGATGAGAATATTTGCGCAATTTGAATTGGCGTGCAACATTGCACAGTGTAACGCAGTCCAC
CCACAGCGATCCACTTGATGCACGTCTGCGCCGGCAGCGAGAAGGGTAGATACTGCCGCTGTCATGCCTCGACTCGCTGCCCAGTGCAATGCAGAACGGT
GGTCAGCACTGGTTAAGGAAATGTCAGCTCCAAGAGCCAGAAGTCTCTGGACGACGTCAATGTGGCCATTGGCTGCTGCACACATAAGTGGCGTCCAGCC
GTGACCGTCGCGGGCGTTTATATCAAGCGTAGATGATCTACTTTCATCACTTCCGTTGTCTTCCATCTGGGGTGTTGTCATTTTGACAAGTACATTTACT
ACATCGATTTGACCGTAATCTGAGGCGTAGTGCAGCGCAGACCAGCCTGACGCGTCTCCTGCGTTCGGATTACAACCTCTACTAATCCATTCCCGGACGA
GGTCGATGTGACCGCGACCACATGCCAACCGCAGTTCTTGCCCGTACTTATACGCCGGGGCATACACCACAGCAAAGATGTTTAGCAGTTCTTCTTTGGA
CAAGTGGTCGAACGCTGGCATAGTAGGTGTCTCTGCAGCAGGGATAACGTCTGGCACAGTCCCATCATTTCCTGGATCACCAATCGCTACAGAATCGCGC
ACCGGAAAACAAGGCACCACAAGCGACTGGTAGAGCTCCTCCGAGAGTGTAAGACCTGCTCGGCGCAATAGATCTGGAATTTTGACAATTGCAATTCCGT
CTTGACTTTGTGTTGGGTTCTCTGCTGCATCTGCGTCAAGCACTTTCGTGAGCACCTCAAAATCCCGTTCACGGAGTTCACTAATGCCCGCCACTTCCAC
TCTAGTCGGACCATCAATCACTCCACCACTTGCCGATAAAGTTGTAAGGCGAGCTGCTGCAGTTGAACCATCACTCGAAGCAGCCAAGAACATCGTCTCC
TTCGTTGGGTTCTTCACGTTTGTAATTGTTAGAATCACATTCGTCTTCATAGCAATTGATGTCCCCTCAGAACCCAAGTAAATCTCTAGCGTGTGTTGGC
TACTATCCCACGAAGCTGCGAGAAGCTTGTTATGATATATGGGCGTGCGAAGCAGCACTTTGGGTTGTTTATCCATATCCCATCCGTCCGGTGGTAGCTC
TACCAACAACTTTCCGCAAGGAGGAACTTTGCCATTGACCGTGAACGCAAGGGTCACATCCGACACTGCTCTGGGATGACAATTAAACGGACTCCAGCGC
TTGGCACCGCCTATCGATCCAGGCACAATCTTCGGAATTGGAAATTCAACAGGGCCATCAATGATCTGTCCACCGCGTGTAGACGATGGCACGGTGCTCC
TGATCACCAGTTTCTCAAAAGTTGTGACAATAGCTTCGCCTTGTGGTGTCGCCTTCTCGGGAGTACCAACACCCGACACCACTAACACCAACGGGGTATC
AGCAGGTATCACACTCTCATTCATCAGTGTAAATTCCATCGTCCGTGACGACAAACTCCATGTCATCTTCACTTGCGGCAGTGCTGCAGTCGTCGCATGT
TC