Description :
From Genome Similarity Track
Location :
Scaffold_31:56288- 57518
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G010610Similar to Dihydropyridine-sensitive L-type skeletal muscle calcium channel subunit alpha-1 (Cyprinus carpio)

Sequence
1230 bases(100 bases per row)
ACGGCTCCAGCCCTTCTGCGATCAGCTTCAACACCACTTCTGTAGTAAACACAGCGAGGATAGCGGAATCCAAGCCGGTGAGGAACCCGCCGATAGCATC
CTCTATCTCAGGCGAAGTTTGCAGCCCAACAAGGGCGCCCGCCATGACGATCACGAGCGTCACGAAATTGGCAAATCTCGGGTGCTCCACGATCTTGGAC
GTGACGTTCGCGAGCTGCAAGTACCGACCTCTCAGCGATTTGTTGTCGCCTTCCTTCTGCGCCAAGATGCCGGTCAGGTCGCAGTCGTCCCACGTGGCCA
GAAGCACTTCGCGCATTTTGCGACGATCCCTCTTTTCGGCGGCCGAAAGCCCCTTTTCGCTTTGTTGCGTCTCTGCTTCTCCGTTGGCTTGCGCAGCAGC
AGCTTCGAGTTTCCGCTTCTCGGCCATCTCTTTTTCTCGCTGCTGGGCCTCCAGAGCGCGCTTTTGCGCTTTCTCAATGCGTTTCTTACGTTCCGCTTCC
TCCTGCGCCGCTTTCATGTTCTCCATACTCTGCGTCATACTCATTGTGATGGCACCAATGAAGAGAGAGAGCATGACGAACGCCGAGATCAAGATGAACG
TGATGAAGTAGAACGTCGCCATAAAGCTATTGATGGCACGCGATTCATTGATGTCGCTGTCCGTGGCATTGGGACCAAAGAGCGCCGTCGTGTTGCAGTA
CTGGAAGCGGTCTGCGTCGTTCGGGTCGTCCGTGTAGTAGCCGCCCCGGAACCTGTCGCACCCAAAGTAATTGATGTTCATGATCTGGACAACATAGATA
TACACAACAACAGCGTCAGCGTACAACGTTTCCATTGAGGGAATTTTACCACCACTTCATGGGCCTCATCGAGATTCAAAGTTGGCACTTACATTCGACC
AGTTCTCGAGGGTGGACATGCGAAAGAGCGTAACCATCGCGATCGGCACGCTTCGAAAATGGAATGCATCGTTGTCTTTCCACGCGTACATACCCGAGAT
CGCGTAGAGGTAGAACACGAGAAACAGCAGCAGTAGAATGTACCCGATGGACTTGAGCCCACCGATGAGCCCCATGACGATCATGTACAGCTGCGGGATC
CGCTTCACAAGTTTCATGATACGCATCAGTCGGAGCATGCGCAGGATCGCAATGTTGCCGCCGCCGAGTGCCGATCCCCATATGGGCAGACTCATGATGA
TAATCCCGAAGTCGAAGCAGTTCCAGCGCA