Description :
From Genome Similarity Track
Location :
Scaffold_62:56278- 60060
Sequence
3782 bases(100 bases per row)
CTACCTATAAATATACTCCGTTTACAATCTACCGTATTTAGGTCACGTCACTCTCTTTTAAATAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTT
TGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACCTGGTAGCACTCGTAGCCAATCCACGCCACCGCGGGTAGACT
ACCTGAACCTCTCCGAAGTTTGTTGCCATGGATAGGAACGACTTCTCCCATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCTGGCATCTTCG
GGATGGAGGCCCTGCAGAGCCTGGTGGTGTCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCGTTCGACGCGTACGAGCAGGGCCTCATCGCGCATGT
GCGGGAAAACCTGCAGGCTCCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGGGAGAAC
CTTCACTTCTGGGTCCGAGAAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCTTTTGCACTCTCCAACGTTAGCGACC
GTGCTAAGAGTTGGGTGTACACACGGGAAGCAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGTGAACAGCTCCGAGCCGCGTTCCTCCCGGC
GAACTGCGAGTACCGCCAGCGTTCGCGCTTCCTCTCGTGTAAACAAGGGAGGCGCGAACAGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGCGTCT
CTAGTGGGAAACCCACTCAACGAACACATCAAGATGACTGTGTTATGGACGGCCTTCGAGTGGGCCCCGCACGCACCCAGCTGTTCGGGGTGCAGTCAAG
CACCCTTGAAGAGGCGATTCAAGTGGCTCTTCAAGAAGAGTACAGCCATCACCAGGCGCGTACGCCGGCCTCAGCATGGCCTGGGAGCTTTTTGTCGGCT
CCCGGTCGAACAAGCCCCAACGGACCAGTTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGCGGGAAGATGGGCCACTTCA
AGCGCGACTGTCCCGCGGAAAGACTCCACAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGGGGAACGC
CGGGAACCAGTAGGGGCGGGGCGCCCTACTAGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGTACCACGGGGACTTAGCCCCTGGGAGTC
TTCGCACTCTCGAACCGGCGAAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGATACGATCATCCCTTTAGAATCTTGATCGATTCTGG
GGCGTCAAAGAATTTCGCACGCCGCCAGACGGTTGCTCGCAACAGCAACAAGTTGTCCGACGCTTTGAGAGAAAGCAAGGGTAACGGGACGGTGTCAGTG
CGACTGGCCGACGGGAAGGTCGTCACTGCCCCCAACGTCCAAGTAGATCTGGCCGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNCGAGGCAAGGCAATTCGGTGCCAGCCGCCCTGCGCAGTACGACAGAGCATTGGTGAGTCATGTTCCACTCTGTCAGGACCCGGGGCGCCCGCAA
GGGCTGCCAGGGTACCAAAGCATCCGGCAGATGCTTGGGAGTCGTCGACGTATATGACGACTCCGAGGATGTTTTGATGGTGGCAACGCCCAGAAGAGGC
GCTGGCAAGTGGGTAACTTAGGTCCACAGGCGGGTAACTTAGTTCCGCAGACAGCTGCAGCTGTCACGAAAACTGAGAACAGCGTGTTCAGAGTGGGTAA
CAGAGCTCCACGCACGGTCGCCCAGACCTTAACTGAAGAGGAAGACGTCGGATACGCTTCCTGTGTGGGTAACACAGTGCCACACACGGTCGCCCAGACC
TTAACTGAAGAGGAAGGCGTCGAACACGCTTCCTGTGTGGGTACCACAGTACCACACGAGGCCACGAGTGCCTCGGATGTCGTAGCGACGACATCCCTAG
ACGTAGGCAGCAAAGCTCCACGTCACGGTCGCCGTCGTCAACGACGCCGCCGCCGCCTCAAGTCGGATCCGAACTTCGTTCCGATCGACGTCGCTTCAAG
CGACTCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAATGTTATCACATCTTCGATGGCGAGACCGGTTTACCCGTCAAGGCATCTGGT
GTCCACTTGGAACCGTTGCCAGAGGTTGCAGCGATACTGAACCTCGAGGAAATGACGGCTGAGTCTTTCCTGACCAACCTCAAGGCTGGAGAGATAGCTG
AGATGGTACTCATGAGACCTGAGACTACTCGGGAGGAGCTAAGCTCCTCCTCTGTCTTGGACGAGAACGTCCTCGAAGACCTGAACAAGCAGCGTCAGAC
GCACTTGGGTTCTGAGATCCTTAAGAACCCCAAGGATCCGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAACAAACACCCACCGACCCAACTC
CCACCGGATCGAGGCGTTCGACACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCA
TTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCGGAAGCCGAACGGAAA
GTGGCGTCTGGCTCACGCTTATAGCAAGCTGAACAACGCAACGGTGCCGGCCCAAACACCAATCCCACGAAAGGATGTGTTGTTGAACAACATGGCCGGG
AGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAAATCCTGATGCGAGAGAGCGACATCCCGCTCATCGCGGTAAGCACTCCAAGCGGCA
TGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGGCGACGCAATTGTTCCTCCCTTTGCGTACCTTCGT
ACAGACGTACTTCGACGACATATTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCATGGAGGTGCATCTAGGACACCTCCGTCGAGTGTTGGACGTA
ATGCGAGCGAATAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATTAACGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTTGGG
CTGACCCGGACAAGGTCAAGGCCATAGCAGCCTGGCCGACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTA
CAGTGCAGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGCCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAGAAGCACCAGGATGCTTTTGACAGC
ATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCTTTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGATGTG
CATTGCTGCAGGTCGACACGGCTGGACACGAACGAGTCATCTCGTTCCAGTCCAGGCAGCTCAAAGCCGCCGAGCGGAACTA