Description :
From Genome Similarity Track
Location :
Scaffold_10:562742- 564327
Transcript NameFunction/comments
Physo_340845Eukaryotic/viral aspartic protease, active site

Sequence
1585 bases(100 bases per row)
GGCGTGAACCATTCTTCCGGTCTGATTCCATCTCCACGTCCCGCGATCCAACGTTGTCGTCGACCACTGGAGTAGGTGGCCTGTTGTTCCTTCAGAAATC
GAGCCATCGCAGCCTGAAAGTAAGACTCCAGTTTGCCATTCGACTCATCTGATCCGGTAGCACTGGTGGTCCGATCGGTCGACTTGGGTTTCTGCTTCCG
AGGTCCTGATCGCATGCGTTCCTGACGTTGACTCCGTGATCGTGCGTCCAACATCGCAGATCCTGAAGGGCCGAGGGACATCCGTTGACGTTCAGACGAC
GTATCCGATACGTGTTCCGCTGCGGAGACATAAGGAGACGACGATCGGTACCCAGGGGACTCCATCCGCGGCGACGACGCGGGAGCTGGCGACACTAGAT
CTAGCACCTTCGGGTCTGGACTGTCCGCGATCACGTCGACCAAAGGTCTCAACTTGTCGACCAATGTCTGGATCGCTATCTGGATCACATCGAGATCCTG
ATCGAAAAGATCATTCGCTTCAAAGGCGCCAGCCACGAAGTCGGCTTCCTTCAACAGCCCGAGCAGGTTCTTCACCGCCATCAGCTTGTTGTCCGTCACT
CGGGGGGCCGAGATCGGGCCCTTCGGGTCGTCGATCTGCTCTGGCCGCAAGATCACCATGACGGGATCTTGACGCAAGAAGTCTCGCAGTTCCTTCAAGT
GATACTGACGATCCAGGTCAGCCTCGGACCAGTCGAGCGCCGACGGTCTGGGATGTTCGTCGTCCAGGCCTGGCGCTCTCAGCTTCTTCCTCACGATCTG
GTCCTTGTCCGCGATCGCGCCCAGGTAGTCCGGATCGAGCCTGATCGGCGAGTCGGCGAACGCGTATCGGTCCGATCCCGCCTTAGTTTGTTTTGTTAGT
GAATCTCGGTTCGCACCAAGATCCACCGGGGTCCCCGAAGGGACCTGGGGAGGATGTTGAGGTTTGTCTTCTAGATCTGTCTCCAGATCGCCCTCGATTC
CGTCGACAGAGGTCCTCCGAGCACTCTGTCGATCCGCGGATCTCGTTTTGTTCAGCAGCGTCTTCGTCGATCCGATATCCGACGACGCCTCTTCCCCTGG
TTCTTTCTTCACATGCGCATCTTCTACGGACTCACGGTGAAATCCGGAGTCCCCACGAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCGGCCA
AAATTTGGTTAAGGTTAAGGCCTGATCGAGCTTCCCGCCAGCGCCCAGACACCGACTAACGGAGGGGTCCCCCAACGATCCGTGATCGGCTGAACTTGTT
CTCACCTTGTGTACCCGTCGGCGGGCTGGATCTGCTCTCTCGGGGCTCCGAAGATGCAGCACTTAATGAAGATCGAATGTCTTGGCGTGACGCGGGGATA
GTTTGTGGAGCAGCGCGGTAATCTTCGCTCTGCGTCCGAGTATACGCTCCGATCGAGGGTTCTTCGCTTCGATCGGTCGGCCTGGAGTTGATCCAAGGCC
TGTAGTTGCCTTTCCGGGTGTGTTCCTTCCTTTCCTGAGTTGCTTGCCGCTTCCTATAGCGGGATCGAGGTTGATCGAGAGGAGA