Description :
From Genome Similarity Track
Location :
Scaffold_209:56273- 60338
Transcript NameFunction/comments
g14623.t1hypothetical protein

Sequence
4065 bases(100 bases per row)
AACTCCGCTTCCACGAGACTTCAGCTGAGGGATAATGTTGTCCTGCAACGATGCCCGTCACTAGCTTGCACGTAGCGGTGAGGAAGCGTCCACTAAGCTC
AGATTCACTGAGACCAAGTATTTAGTCTGGGGTAAAATCAACCCTGTTTTATTATTGCGACCAGGACAGGTGCCCTCGGATCCATGTGAACCACTCAAGT
ACAGGTCGACACCTGATTGGTCGAACTGGTTCTGGCTCCTCACTTTCAACCTACCATATGATGACAACAAGGCACACGCTAGCCGTACCTACTTTGTAGA
TCTACCTAAATAGATCTACCTGCATATGAAAATGGGAGGGGCCCATTACATATACCATCAAAATAAACTGACAAATATCACTCAAATCGGCCAACACGTG
ACGTACTCCAGCATTGAAAGTCGCCGGGGCGTTAGAAAGGTCCAAAGGAAGCACCAAATACTCATAGGCACCGTCCGGTGCTTGAAACGCAGTAAATTGT
ACATCGGAATCGCGCACTCGAAACTGGTAGTAGCCACTGAGGTAATGCATGCAATTAAATTAGTAGCCATTTTGCATATTGATGATATTCTTGTCTTTCC
TAGGTATGGTAATGAAGTTCTTTCGAATGGTATGCGTATTGAGGGCATGTTAGTTGTGTACGATCCGCCGCACCACTGATTTCTGAACACAGAAAATAGG
TGCACCGTTTGACGGTGGTAAACGTCAAATCATTCCGGCCGCTAACATCTAAACTAGCCAGTCCAAAATCACGTTTCTTGTGCCGGGAGGAAAGGAGTCA
CTGATGTCGGAAAATTGTTTCCTTGGTATCGATTTCAATTTCGTGTTCGCCATGCTCGAGAGGTGGTAAACATGAGGGCAATTTCTGCTGAAAAACCAAT
TTGTGTCGCAGTAGCATATGATAAGCTGGACGGTCACGGTATTATGTAATATCTATTAGCTCCTGAGACGCTGGTTTGCTTTCCTTCTTCATTCTTTGGT
TGAATCACACACAAAAAACACTCAATATCCAGCTGTTTCTTCAATATGCAACGATATTGCTTACCGCTGATGTATTTAGTCGTTCCGTTCTGAATAGAAA
CATACCCACACGTGAACATTTCACCAGTACTTCTCTTCGGTCGTACCGGAGACAGCTCCGGTTCAGTTGTTGTCGGTACCGGATGTTGCTGGGGTGGACT
CACCGCGCTATCAAGGGCTTCAGCGTCCATTTGCGGAGACGTCTGTGCCATCGCATGAGTTTGATTCAAAGTGGTCAACATGTTCGTCATTCCTTAGAGG
AGGTTTGCCAAATTCCCTTGAATGTCGGTTATCTCAGCAGAAACCTGTCGCAAACGTTGGTCAACGATGTTGTAACCTTCAGTCGCAAGCTATCGTGCAA
CGATGTCATCCCTTGGCGCAAACCATCTAATGATGTCTCCAGCTGTTGATATTGCGCTGGGTTGTTGGCCACAGCGTCGTTTTCGCTATTTTCCAGTTCC
AATAGTTGTCGCGCGGGAGCTGTGTCGCACATTCGTGCGCGCCGCGCAGTGTTACGCTTCATCATCGCCATCAAGGTCTACTTTAGTTAAGCTCACTACT
CGAGCTCGGTTAAAGAAGCGATTTGGTAGCACTTGCAGCGGAAGTTAGGTAGGTGGAGTAGATGTTGTCGTGGCGCCTCTCACTCAGTTCGTCGAGGTCG
TGAAGAGCCATACAAAGCTGCTTGGTCAAAGCAGCAGGAAGAAAAAACCCAGTTGAGTTCTTTGTGTATGATTCCGAAATAAAACTAAAATCAACGCTCG
ACATTGGCCAAGCTCCTATGTGTTTGTGCAACCTGAATTGCCACGAGGCACCAGCCATGGGTGCGACCCGATCTTGTTGCTGATAATATCCACGGACGCA
ATATTCTAGTCCCATTCTCGTCGCTTGCTGTATGTAGCTCTGTGACAATTGGGTTCAAGGATGGTAATTAAATTATATATCTTCTCTAGATCAAAAGAAA
CGCCATTGGGCGTGATGAACCGTCCACAAACGTTGCACAAATTTGATCAAGGTCACCGAATAGATCAAATTCTGTCAGCGTGCTGTACACCCGGTCTAGT
ACTGTGAGAGATACAACGTTATTGTCGGAATAAAAATATGTCATTGACCCAAGCCGGCACTACTTGTACAATAAGCCGGCTTTGCGCATTTTTTTCTGCA
TCGACTGATGAATATGAATTGACGAATCAGCGAAAGCGCGTTGGCGTGAAGATCCCATCTTCAATCATGTACGTTCTTGACTTCCCGAAGCAAGTGCCAT
CTGCCATATTAAATGGCATATATGTTCGTTATTTTAGTCGCCTCGAAGGTTGTGTAGCTAAACAGCTCTCCAAGTACCCCCTTCCTTGGCTTATTACGGT
ACTGCCGCGATTCTCTACAATGAATCCGCAGAGACGCTAGTACAGCATCACATCGACGTTGACATTTGTGGCCTCTGACGTGCTTGAAAAGCTGGCGACG
CAGGGTCAGCAGCTGAACATACTCCAAACCAGGGCGGAGCTCCTTCAGCGTTATCATCGTTGGCGTAGCGTACAGCAGGTGCTGGTCCCTTTTATCGGGC
TAAGACTTTGCTGGCACTTAGATCTTCGTGCGTAGTAGTTCCGACGTACACAAGTGATTTGGTGAGGGAGTCCATCAGCCAAGCGCTACATGTCGAGATC
CACTCAATCGCAAGTTGCGGCGACGTGTTCGCGTACACCACCGACCCGGTGGCTACTAAGTTCTGCTGTTAGTCTGGAAGGCAGTGGGGCGGAAGCTTGG
GACAGGCGCTCGGAGAATAAAGTGATAGCGTCGTTAATATCCGTGAATACATTTGGTTTTCCTCTCACGCGCTTGGTTGGTGGCTCACCCTGTGCCTCAG
GTTTCTCTTCCAAGTTTCCCCCGTACAGAATAGCTTCTTCTTGGCTGTATGTCTCTCCCCCAAGTAATTGCAGTTTCCTGCACTCTAACACGCAAGTCAC
CGAGCGTGCACACTAGAGCTTCTCTTATCTGCACGCCTGCAAGCAAATTTCGCTCCTTGATGGCTAAGGCCATCTGGTCTCGATTTTTTGCAATTCGCTT
GCTATCTGACAAGTGCTGGGGGATACCGCTCGCGTAAAAGGTCCACGAGTAGAGACATATACCCCACAGGGGTGGCCATAGTGAGACGGCTTACTCGAGC
ACTTGGCTTAGTTTGCAGGAAAATGGAAAAGACAGTTAGCAACGAATAAAGTTTTGACTAGGGTGAGCATCAGGAATCAACAGTGTTTTAGCCATGCTAG
CAATTGAGCCCTCATTCTTGTTACCCAGAGCTTTGAATTCACTGAAGCATTGCCTCGCTGCAGTCTCCTGTCCTGCCGTTCTTTGTAGAGTGATAAGCCG
TCACGCCACGTGCTGCATCTTTCCAAATGCTAACGTAGTAAAGGCTTCGCCACCAACGGCCACAATACTATATTTACTCTTGAATTTTGTATGGGATATT
ATTCAAGAACAGCTATGAATTTCATAAGTAGTTGGAGAACCGTTGGGACTCAGGAGATGTCGAGTATGATTAGCTAAAATGTGTCATGCGCTTGCCCTGA
TTGGATGGATATCACGAGCGATAATAAAGTCGGGAGTAAGCTTACTTTTCCCCGCTGAAACAACACAAAACAACATTGTGTTTCGACCAATAAAAATACC
CCATACGAAATTCAGAATTCGCGAATAAGGGTTCAAAAGGGAAATCTCGCATTCAGTCGTAGAAAATTATCTAGGTGGGAGGAGACGCAGGCGAAGAGAG
CCGCCCCTTATTGAAGGGCAAGTGCGCCTCCTGCGGCAAGAAGGAGCCGCCGAAGACGCGCAAGGTGATCAACCGCGAGTGCTACGTTCGCCATAAAGAT
AAAATCTTCAGCAAACGCTTCGAGTAGCGTATTTACGAATGAATTTTGCTCATCTTCAAGAACGATTGCGCACGTACCTCAAAAGAACGGAGAAACATCT
TGCGTCAGTTGCGCTAGCTGCGGCTAACTTCAAGGCGAGGCAAGAAAAGGTTCATCAAGCGCTAA