Description :
From Genome Similarity Track
Location :
contig_42:562624- 563712
Transcript NameFunction/comments
g9140.t1hypothetical protein

Sequence
1088 bases(100 bases per row)
CACCGCGGGGTTGACCAAGGGGCACGACCTCTCCTCCGTGGGGCTCATGGAAACTGAGCAAGGCGCCAACTGGATCTCCACCTCGGGTAACACTACCACG
ATCGAGTCCATCCTAAGCGGAGGAGGCATGGACACCGTTCGGCTTCGGTATTTATTCACCTGAAAACTACTTCGGTAAGTACCAGCTACTAATCCTGTGA
ATGGTTCTGTACAGCATCTGGACGGACGGCGAGTACGATCTGGACTACACGTTGGCGCTGGCCCAGCGATTCTCCAAGGCCGGGTACAAGATCTACTTGG
ACATGCACTTCTCCGACACCTGGGCCGACCCAACCGACCAAGCCATCCCTTCGTCATGGGACGACAGCTCGGTCACAACTCTTGCCGCTGATCTGCAGGC
CTACGTGACGTCGACACTGAAGTCCTTCACGGACGGCGGAGTCGACCTCGACATCTTGTCGTTGGGCAACGAAATCACCGACGGATTCCTCTTCCCGACC
GGTCAAATCAACAATGACGACTTCAGTGCCTTTGCTACGCTGTGGAAGGCTGCACGGCAGGGCGTGACAGACGCTGTATCGGCCGGCACGACCCAGCCCA
AGGTGATGATCCACCTCGATAATGGCTGGAAGTACGAGACCGTGTCGTGGTTCTTCGACGGTCTTTTCGCGGAGGGCACCGTGACTACCGACGACGTGGA
CGTGTTTGGCTTCTCATTCTACCCGTACTACAGCACGGACGCTACCATCGACGCCCTCACGTCTTCTCTGACTCAGTTGGCCAATTCGTACAGCAAGCCG
ATCTACGTGGCCGAGACGGACTGGCCGACGGAGTGCTCGAGCGTCACACTGAGTGGTGACTACCCAGTGAGCGCCAAGGGCCAACGCGAGTGGGTGATCG
CCATCATGGACGTCCTCGAGAGCTTGCCCAGCAGTTTGGGCGCTGGTATTTTCTACTGGGAACCAGCATATCTGACGGTGGCAGGTCTCGGAAGTTCTTG
CGAATCGGCGCTGCTTTTTAGCGTCAATTGGGACAACTGGCCGGAGACGTACGCGACTGCGCTTTCGTCGATCAACATGTTCTCGTGA