Description :
From Genome Similarity Track
Location :
contig_42:562607- 563695
Transcript NameFunction/comments
g9583.t1POM61633.1 putative beta-galactosidase [Phytophthora palmivora var. palmivora

Sequence
1088 bases(100 bases per row)
CACCGCGGGGTTGACCAAGGGGCACGACCTCTCCTCCGTGGGGCTCATGGAAACTGAGCAAGGCGCCAACTGGATCTCCACCTCGGGTAACACTACCACG
ATCGAGTCCATCCTAAGCGGAGGAGGCATGGACACCGTTCGGCTTCGGTATTTATTCACCTGAAAACTACTTCGGTAAGTACCAGCTACTAATCCTGTGA
ATGGTTCTGTACAGCATCTGGACGGACGGCGAGTACGATCTGGACTACACGTTGGCGCTGGCCCAGCGATTCTCCAAGGCCGGGTACAAGATCTACTTGG
ACATGCACTTCTCCGACACCTGGGCCGACCCAACCGACCAAGCCATCCCTTCGTCATGGGACGACAGCTCGGTCACAACTCTTGCCGCTGATCTGCAGGC
CTACGTGACGTCGACACTGAAGTCCTTCACGGACGGCGGAGTCGACCTCGACATCTTGTCGTTGGGCAACGAAATCACCGACGGATTCCTCTTCCCGACC
GGTCAAATCAACAATGACGACTTCAGTGCCTTTGCTACGCTGTGGAAGGCTGCACGGCAGGGCGTGACAGACGCTGTATCGGCCGGCACGACCCAGCCCA
AGGTGATGATCCACCTCGATAATGGCTGGAAGTACGAGACCGTGTCGTGGTTCTTCGACGGTCTTTTCGCGGAGGGCACCGTGACTACCGACGACGTGGA
CGTGTTTGGCTTCTCATTCTACCCGTACTACAGCACGGACGCTACCATCGACGCCCTCACGTCTTCTCTGACTCAGTTGGCCAATTCGTACAGCAAGCCG
ATCTACGTGGCCGAGACGGACTGGCCGACGGAGTGCTCGAGCGTCACACTGAGTGGTGACTACCCAGTGAGCGCCAAGGGCCAACGCGAGTGGGTGATCG
CCATCATGGACGTCCTCGAGAGCTTGCCCAGCAGTTTGGGCGCTGGTATTTTCTACTGGGAACCAGCATATCTGACGGTGGCAGGTCTCGGAAGTTCTTG
CGAATCGGCGCTGCTTTTTAGCGTCAATTGGGACAACTGGCCGGAGACGTACGCGACTGCGCTTTCGTCGATCAACATGTTCTCGTGA