Description :
From Genome Similarity Track
Location :
Scaffold_538:5626- 6954
Transcript NameFunction/comments
Phypl_g9231hypothetical protein PHYSODRAFT_336177

Sequence
1328 bases(100 bases per row)
GGGTAGCCCACACCCACGATCAGGTTGGCAGACCAGGCGGTGAGTATGCAGATGGAGGTGACCGTAGCACGGGCATAGTCGGGGAAGATATCGGCGATGA
CCACGTACATCAGCGGACCGAGACTCACACCGAACGAGCCGACGTACGTAGCGATGAACAGGATCGACAGAGCCGACCAGctgaacgacagcgacagcgt
cacGCCAATGGCGCTGACGAACATGCCGGCCAGCCCACACAGCAGCATTCGACGGTTACCGAAGCGAACAGCGAAGAAGCCCGACaccagcgtcggcagc
atgTTCACAATGTCAATAATAATAGTGCTCACACGGGCGTTGCTCAGACCAGCCTGGTTGAAGAGATCCGACGAGTAGTAGAAGACCGTGTTGATACCCG
TGATCTTCTGCATGCAAGCAACACCAATGGCAATGATGAACTGGCGGCGAAGAGCGGGGGCAATCAGCTCCGAGAAAGGAACACCCTTGCCGCTGCGAAC
CACCTCGTTACCAGTCTCACTCCAGGTACTCGACTGCATCTCCATGtcgtgcttgcgcttggACTCGATCCATTCCAGAGCCACGGGAACGCCTTCGGCA
CCGAAGAGGCGAGTGAGCACAGCCTCAGCCTCAGCGCGACGGCCCTTCAACAGCAGCCACACAGGCGACTCCACCATGAGGAACGGCGACATGGTCAGGA
AAATAGCCGCCAGTACGATCGGGAACGCAGCGATGTAGCGCCAACCGTTCTCAAAATCCATGTAGAAGAACGTCGTTGCGACCAACAAAATACCGACGGT
GATACCACTGTGGAGAACGGCGCCGAGCAACGAACGGAGGTGCGGTGGCGATATCTCGTTGATGTAGCCGCCGACGTTGCCCGTCGTGGCACCCGAGGCG
ATACCAGCAAGGAGACGACCAACGGCGAAGACCCACAGGTTCGAAACCACGGCCATGACAACGGCACCTGCAATGATGAAACCGCAGTTGTAGATAAGGA
CTTGCTTGCGACCGAAGCGGTCGGCGAACTTGCCGACGAGACCAGCTCCGATCATGCCTCCGAAAATCCACGCGTTCACGACGATCGTCCACTGGAACTT
GGTGTGGCCGGGGAACATGATGCACGTGTCCTCGGCAATCGGGCGGGCATTGCAGTCCTCGACGTTGTTAAACTTGTGGAGATTAAGCTGCGATGTCGAC
CAACCGtactgcagcggcagcacgaaggcgagCAATGCGCTCGTGTACAGAATGTAGGTGGGCTGGACGCGTAGGTGagcctccacgtcctccggCTCGA
GCACCGTACTCTGGATCTCGGGCGTCGT