Description :
From Genome Similarity Track
Location :
Scaffold_293:5625- 6844
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_293-fgenesh-gene-0.9WD repeat domain 31

Sequence
1219 bases(100 bases per row)
GGCGGAGCCGTCGGCTGCTCCTTGTAGAAGCCGAACTTGCCGAGAGCAGGGATATTGAGACCTTTTCTCGCCTGGAGATTTCGTTCGATTGCTCGACCTA
CGACCAGCCAGAGGCGTTCAACGCAAGCACCGAGGAGTTTCTCGAACTCGAACGCTGAGCCGCGGAGCGTCTGCGCGCAGTCGGCGACGACATCGTGAGC
TCCCATCGATGAATCACTCCGGTCACTGGCCAACGCAGCGTGGAGATGACAATGTGACTCGATCGCCGGAGTCTATTTGTGCTACATCGTATATATAGAG
TCGCCTCAATCATCGCCGTCAAGCGGGACGAGCTGCCTGGAGTCTGGTGAGAAGGCGTACGCATGCACGTGGCCACTGAACGTGCTCGCGAGAACAGACG
CTCTCGAGGATCCGCCAGCGCTGCACACGCTAGTGAACATCCCCGTCGCGGCCTCGTGCCGCTCGCAGAGCAGTTCTTTCGCTGCAGTATCCCAAGCCTT
GATCGTTCCGTCCTTGGACACGCTCACGGGGAACGGAATCGAGCTGTCACCGCTCGACATTGTCGTGAAGCAGCACGAAGTCGCGTCTTGCTGGTGTCCG
GCGAGCTCCATGAGCTGCTGGCCAGTCCGCCTATCCCACACTCGGACCTCCGCCCCGACGCCGTTGAACCCCTTGCTCGACGTCACGATATAGTTGCCAT
CGGGCGATACATCGACGCTCAGCGCAAAGTAAATGTAGCCGCGGTATGTCTGCACGGGAGTGCGGAGCGCCGACCGCGCGTCCCAGATCTTGACGCTTAG
GTCCTCGCTGCCCTGCACAACCAGCGGCTCGTTCGGAACCCACTTGGAGCACGTGATGACGTTCTGCGGGATTGTATTCTTGGCGGTCGCCGTGGCCGTC
TCCAAGTCCCACAGAATCGTTTGCGTGTCGCGTCCACCTGAGCACAGAGTGCGTTCCTCCCGGTTGACAGCGATGGTTGCGACGTTCAGCGTGTGGCCGC
ACAGCTTTGCGTCTGGTAAACCGTCTTTGTCGCCGTTGCCATTGTGCCGAGCCGTGATGGCTACGGTGGTGTCTCTGGAGCAAGTGTAGACGCGAGTGTC
GCCCGCAACGAGGCGGTTGACGGCCCGCGAGTGCGGCTTCCACGTCTCGACCACGCGCTTGGACTGCCAGTCGAGTTTCCTGACGGTACCATCCTCCCAC
CCAGTCAAACACATGGTCT