Description :
From Genome Similarity Track
Location :
contig_32:562458- 563531
Transcript NameFunction/comments
g7397.t1ETI36938.1 hypothetical protein F443_17041 [Phytophthora parasitica P1569

Sequence
1073 bases(100 bases per row)
GCGGCTGGTGGTGCAGATGCAGGCACCACGCATGGCAAGAGTAACGGCAAAGGCGCGGGCGTGGGTGGCTTCCAGCACCTGGGACTGAGTCCGTTGGTGT
TCCGTGGCGTCATGGCCATGGGCTACAAGGTGCCCACGCCCATCCAACGCAAGTCGCTGCCCATTGTGCTGTCGGGAAAAGACTGCGTGGCCATGGCCCG
AACAGGCTCCGGCAAGACGGCGGCCTTCCTCATCCCCATGGTGGAGAAACTCAAGGAGCACTCGACCAAGATCGGCGTCGTGCGGTGGTGCTCTCACCCA
CGCGCGAACTGGCGGTGCAGACGCTGCGCTTCACGAAGCAACTGTCCAAGTTCACAACGCTCAAGATGGCGCTGATTGTCGGTGGTGAGGGCATGGACCA
GCAGTTCGAGGCCATTGCGGCCAACCCGGACGTGCTGGTGGCCACGCCCGGCCGACTGATGCACCTCTTGCAGGAGATCCCGGACTTCAATCTCAAGGCC
GTGGAGTACGTGGTGTTCGATGAAGCCGACCGCATTTTCGAGATGGGCTTCGCGGAGCAACTGCAAGAGATCCTCAAGAACATGCCCACGAGCCGACAGA
CGCTGCTGTTCTCTGCGACGCTGCCCAAGGCGCTGGTGCAGTTTGCACGCGCTGGTTTGAGCGACCCGGAGCTGATCCGACTGGATGTGGAGAACAAGAT
TTCAGAGAACTTGAAAATGGCCTTCTTCACGGTCAGGTCGCTGGACAAACCGGCGCTGTTCCTGTACATGGTGCGTGAATTCCTGCCCAAGGATGACCAG
ACCATTGTGTTCGCGGCTACGCGTCACCACGTGGAGTTTTTGCACGCACTGCTGGCGGCCAACCACATTGAGGCCTCCTGCGCCTACGGTGACATGGACC
AAGCCTCGCGTAAGATTAACCTGGGCAAGTTCCGCGCCAAGAAGACCAACCTGCTTATTGTGACGGATGTTGCTGCGCGTGGTATCGATATCCCGCTGCT
GAACAACGTGCTCAACTACTCGTTCCCGCCGACGGCCAAGCTGTTCGTGCATCGTGTCGGTCGTGCAGCCCGT