Description :
From Genome Similarity Track
Location :
Scaffold_38:56206- 62461
Transcript NameFunction/comments
Hyaar_Emoy2805342DEAD/DEAH box RNA helicase putative
Hyaar_Emoy2805343unnamed protein product
Hyaar_Emoy2805344unnamed protein product
Hyaar_Emoy2805345metalloprotease family M20D, putative

Sequence
6255 bases(100 bases per row)
GATGATCGCTTTGCTTCTCGTAGGCGCACCGTGACTTTTGCCCTTGACGTTACCCTTGCCACGCTTCGACCTCACGCCAAAAGTGACCTTGGCACCGCGC
GAACGAGCCTTGCGCTTCTCCTCCTTGCGGATCTTGTCCTCGTTCACCAGCTCATCCTTTGCAAACATGTTCACATGACTGCGGTTGACCATGGGAACGC
CACCACGCGGCTTCTTCCCATTGCGATAGTCCATCTTGCGACTCTCAGCATCAGCATCCTCCTCCATTTCGACACCGCCACCAGCAACGCGTTTGTGCTG
CTTCTGCTGCCACTTGCGGTACGCTTCACCCACGTGGTGTTTCTTACGGACACTGATACCGCTCTCGTTGCGGCGCTTGAGTGTGCCCTGACTAGTGAGC
TCACCAGCAGTAGTCTTGACAAATTTCTTCTTGCGCACATCCCAGTGCAGAATACGACGCTTCTTGTTCATCTCAATAGCCTCATCGGGGTTCACATCCA
AGATGGCTTCCTCCAGACGAGCTTCCGCAAAAGCATTCACCTTGCCACCATCGGCATTCTTCGCCAAAAAGCCCTCGGTAGTGTAGTCGCCATCCTTCAT
GTAACTGATGTAGTTATCGTCATCCTTGAACGACGAGTCTTCTCCATCTTCCTGGTCCTTGCAATTCGCAACGCCATTTGCTCCTTGCTCCTTAGCTGCA
GCCATCTTCCTCAGTACGTCTTCTTCTTTCTCACCAGCGGCCACACGTTTCTTAAGCTGTTTGCGATCGTGTTTGGACAAAAACACAGGCTTCTTCTTCG
GAGCCAAAGCTGCTTCCTCCTCTTTCGTCTCCACAACATCGACCGCTTTCTCCTTAGCTGCCACTACTTGGCCATCGGCACCAACCATTTCCTCCTTGTT
GGCCATAGCGTTAATGGCAGCTGCCTCTTCATTTGCCTTGACTATATTGGCAGCCTTGGTTGTCTCAGTAGCAATGATCTTGCCGTGCAGCTTTCGCTTC
TTCACCATCATTTGTACACCAGGTGACGAACGCTTTACCGACGAGTGTGCACCTGCAGCAATCTCAAAGATCGTCTGAGGTGGACGAAACGAAAGCAGCG
AGTCCACGTACGCTGCCTTATCAGCCTTGGTTTTGTCAAGCACGTATTCCTGCTGAAACAAAGGGTGAACCTTCTTCACTGCAAGTTCCTTCCCACGTCG
AATGGAGAGTTTCGACGGGTCAGAGCGGGTACGTGCGTAAGCTTTGTAAGCGTTGTCGCAGACCTTCACGAGCGGAGACACTTGCGGATGGCTAGACATC
AGCTCCGTGATGGCTTCATTCTCTTGATCAATTAGTTCATTAGGAAATGCTCCATAATGAACATCTGCAACCTTCATAGAACTCAGCGAATACGGCTTGG
TGCCGGCGTGTTCCTCTGGTGAAGAATCCTCCAGTCGGCGCCCGATGTAAAGGTGCAAGTCAACCATAAATGGAGTTTCATCAGGATCCACAAAGCTGAA
AGCTGTACCACTACGACCTGCACGAGCTGCACGACCCACACGATGTACGAAAAGCTTAGCCGTAGGCGGAAACGAGTAATTTAGCACATTATTTAGCAGT
GGAATATCGATACCACGAGCTGCCACATCTGTCACAATGAGCAAATCCGTCTTCTTGGCACGGAACTTGCCCAGATTTATTTTACGAGAGGCTTGATCCA
TGTCACCATACGCATATGATGCCTCAATGTGATTCGCCGCCAACAAAGCATGTAGAAACTCTACGTGATGACGAGTAGCCGCAAAAACAATCGTCTGATC
ACCCTTGGGCAAAAACTCTCGGACCATGTACAGGAACAGTGCCGGCTTGTCCAACGATCTCACCGTAAAAAACGCCATCTTTAGGTTCTCCGAGATCTTG
TTCTCCACATCCAAGCGAATCAGCTCAGGATCACACAAGCCAGCCCTTGCAAATTGTACGAGAGCCTTTGGCAACGTTGCCGAGAACAACAGCGTCTGTC
GGCTCGTGGGCATATTCTTCAAGATCTCCTGCAGCTGCTCGGCAAAGCCCATCTCAAAAATACGGTCCGCTTCGTCAAAGACCACATACTCGATAGCTTT
CAAATTAAAGTCAGGGATTTCCTGCAAATGGTGCATCAGTCGACCGGGTGTCGCAATGAGCACGTCCGGGTTCGCTGCAATGGCCTCAAACTGCTGGTCC
ATGCCTTCACCACCAACAATGAGCGCCATCTTGAGTGTAGTAAATTTAGCCAATTGCTTCGTGAAGCGAAGCGTCTGCACTGCCAGTTCGCGTGTAGGCG
ACAGCACCAGCGCGCGCACGCCAATCTTGGTCGAATGCTCCTTGAGTTTCTCCACCATCGGGATCAAGAAAGCAGCCGTCTTGCCTGATCCAGTCCGGGC
CATAGCAACGCAATCTTTTCCAGACAGCGCGATAGGCAGCGACTTGCGCTGGATGGGCGTAGGCACTTTATAGCCCATGGCCATGACACCGCGGAACACG
AGCGGACTGAGGCCCAAGTGCTGGAAACCACCTACCCCTGCACCTTTTCCATTGCTCTTTCCATGCGTCGTAGCAGTATCAGTCTTACTAGGCGCGTTCT
TCTTGTTCTTCGCTCCTTTCTTGAGCAAATCGTCTGCCGCCATTGCTCCGAGTGCGGTTCCTGTCGATGGACGTCAAGTGCGGACGAAAAAGCACTGGAA
GCCAGCGAGTGGCTTTGTCGTGCGTTGATTGGATGAAATAGATCCTTATTAAAATCATTAATTTTAAGATTATTCATTTTTAAACCCTACCCCTTATAAG
CGTGTGCTGTGTCGTTTACTACTACTACTTCATATGTCGCTGCGGGACCGCGCCGTGACGCGGGACGAAGAGGACTGGGCCGCTCGAGGCAACGACGTGG
CTGTGGTTTCAGCAGAAGAAGTAGAAGCTGGTGTTGTGGATCTTCCAGCGTCCCTTAATGGACGAGTAGATGCTTCGGTGGATGTAACAGACGATTATGC
TAAGGCCGCTGACTTTGCGGTTCTGGGTGATACCTGTCCCATCTGTCTAGAGACGCTGGACGACCCCGTTATGGTCAAGGTCTGCTACCACGTCTATTGC
TTGGAGTGTCTGAGCACGTGGGTGCACAGTCTGGCTCTGCATGGAGTGGAGGTAGCCACTTGTCCGCTCTGCAAAGCTTCGTTCCAAGAGGTGTACGCCA
ACGTGCGGAGCGAGTCGGACTTAGAGGTTGTCTGCTTTCAAGGGAAGCAGATGCAGAACTGGAGGTTGAGAAGTAGTAGGAAAAAAGACCAGAGAGGGGA
ATCTTGTCAACGGTTACGACGTCGATCGCTGGTGTATCGACGTCGCATGCAGCTGGTTCGAGTGGCTGGAGAGGAGGTCGCAGATGTAAATTCGTTCCCA
ATGATACGCAAAGTGAAGAGCGAGTACGAGTCGTGGCTAGCTAGGGAGCTGAACGCGTGTATTGGACGAGATATGGATTTGACAGTGTTGCTGGCTATTA
TCCAATGCTGTCTGGATAAGGTGGCGCAGTACGGAGCCAAGGTGTGTTACGATGAACTGCAACAAGCGCTGTTGCCATTTCTGTACGAGGACGCCACGCA
TTTTGTCCAAGAGCTCGCGTACTTTTTGGCCTCCAGGTTGAATGCTGAGGCGTATGATGCAGCAGTAGAATATCGATGTGAAAACGCTGCCGAGTGTACA
AACGCGCTGTGCTGTGGCAGGTGATCGGGTACGCTCACACCTTGGTACGTCTGCAAAGACGTGCTGGGACGCGTAATTTTCATAAACGAGTGTGCAGTCG
TTGAATAGAACGGGTCTACCGGCATGATTGAGGTTACTGTTACTGCCAGCGTCCCTTCAAGTAGTCTATCTATGCTTTGCCCAACACAAGAGCGAGCAGG
GCCATGCGCACGTACATACCATTCTCCATCTGGCGAAAGTATGCAGCGCGCGGATCATTGTCAACCTCTTCGGCAATCTCTCGAACCCGTGGTAGCGGAT
GCATGATGACCAGCGTTGTCTTTGCATCCTTGATCGTGTCCAATGTAATGCGAAAGCTGTCTTTCACTGTGTTGTAGTCGGCCTCGGACTCGAAGCGTTC
CTGATTGCAACAAACAAGCATATAACAACATGATGGTTCAACATGAAGCGTTACAACGCACCGCTTACCTTTTGCACACGCGTCACGTAGAGCACGTCGG
TCTGGTTAATGACCATGTCCAGATCAGTTGTCTCAATCTGTCGGATACCCTGTGCCGCCAGTTCATCGTACACATCGCGCGGCATTTTCAAGCTCTCGGG
CGACACATAGTTGAACGTCGTGCCGTACATTGCCAGTAGCTTCGACAGTGAGTGCACCGTACGACCATACTTGAGGTCACCAACCATCGTAACAACCTTG
CCCTTTAGATTATCCAGGTCACCAACCTCGCTGTAAATTGTGTACAGATCCAGCATAGCCTGCGTCGGGTGTTCACCCACACCGTCACCAGCGTTCAGCA
CAGGCTTCTTCGTAGCTTCAGCAGCTATCAAAGCACTGCCTTTAACCGGGTGGCGAAGTACGATCACGTCGGCGTAGCACTCAAGGCACCGGATTGTATC
ATAAAGTGTCTCTCCTTTCTTACTGCTGGACGAGCTCTCATTGACACACACCACAAGGCCACCGAGACGCTTCATCGCAGCTTGAAATGAGCTGCTCGTG
CGTGTAGACGGCTCCATGAACACGTTGGCCAACAGCTAGCAACAGCATCAAAAAGCAACGCAGGTCAGCTACAAAGATCCATCGTAGTTCAGTACATTGC
AAGGCACACCTTTCCCTTAAGCAGGTCATTTGCACCCTGCGTCTGGACCATCTGCTTCATCTCATCAGCCACGCAAAGCACACGTCTACAGCACCAATTT
AAGTAACCCCCCCCTCTATCTTCCAACAATAGCGAGCATCTCACTTACTGGGCGCTCTCCTTGCCAAACTGTGCAATCGACAAAATGTTCTCGCCGTCCC
ACGAGCCCACAGTCGCCTTGCCGTCGAGCACGTGCGCCATAGCAGAGTGAAAGTCTGACGTTGCATCGCCACTGGTTGGGACAAACTGGCCAGTTTTTGC
TTGGCTTGAATCGGACGCATATTTCAGCGAATCAGAACGGATGGTGCCTAGCATGTTTATGCGAACCTAGTAATGCTCCTTCAGCCACTCTATTTCGTTA
AGGCACCGCATTACCGTTCCCCTCCGCTCAATTACGACACCGTAAACGTCTGCGTACTTAGTCATTCTTCGAGTCAAAAACAAAACGTGATGGGTGACCC
CCATGAGCAGGATCCGGAGCTGTATACCCAGCAGCAGGAGGCCCACGAGCACGCCCACGCGAACGGCAGCGAGACCAAAAAGGCTAAAAAGGGCTCTGGC
AAGCGATTGAACGACCGCGAGCGCGTGGATATCATTCAAATGGCCGAGAACAGCAAAATCTCCAAGCGCCAATTGGCCGATAAGTTCGGCGTGAGCGAGG
CGGCTATTCGCAAGCTGCTGCTCAAGAAAGACGACTTCTTACGACGTTACTATGACACACCCGAGGACATTCGTGATCAGCGGTTGCGTGGCAAGAGCAC
GCGCGTTCGGGCGAACACCTCGGACAGCTGCGAAGGTGCTGGTGGATCCATACAACGCTCATGTGAATCGACGCCGGTTAGTCAGTCGCCATCTACTATG
CACGCTTCTAGTATGGGTGTGTACCCACCTGACGATCCATGGAAGTATGGGCTGCATGCAATGTTAACCAAGGTCATGCCATTTTTAAAGAACTTTACCC
AGAGCAGAAGAGAGCCGCACACGGCGTTGGAAGCGTCGATTACTGCTACGGATCAGGATGTTAAGGCTTCATCAGTGACGGTGGAAGAAGTGGCAAGTGT
GGAGAAAAGGGACTGGATTAGCTTTTCGCGCATGCTGCGCGATATCCGACGCGCGCTCCATCGATATCCCGAGACGGGATATCAGGAAGTACGCACACAG
GCTTTTATCAGAGGATTCTGTGAAAAGGCGTTGCAGATTCCGAGTAAGAACATCCGAGAGATGGCGTCTACAGGACTTGTGGTGGACGTGTGCTACGAAA
ACGCGACCGTTTCAGCATCGGAATCTCGCAAGCTGCCTGTCATAGCCTTCCGTGCAGATATGGACGCGCTTCCAATTGAAGAACTGAACGACCACTTGCC
GTACTGTTCTACCCAGAAACAAGGCCTGAAGGAGTTTCGAAAACGTAAAAAGCGA