Description :
From Genome Similarity Track
Location :
Scaffold_246:56195- 59879
Transcript NameFunction/comments
Phyci_142293Hypothetical protein

Sequence
3684 bases(100 bases per row)
AGCCACTACACCAGACTAGTCCAGACAGCTCTCCAATCTACCAACTTGTGGTCGCTGCGTTTTTGGACGAGATGCTATCGTCGTTGGGTTATATGGAAAA
CCTTGAGGGTGCGCAGCAGCTGCATGCTATGGTTAGATTCGTTTTGCCGGCACTTTCCAATGCAAGTGTGGCCCAACAAACTCTTGGAATTGACGTGGAT
GACAGCAACATGACTGGCATTATTGCAAGTGGAGAAAGTGCCGCGCTTCATGATCTGTTGACCAAGACTAGGGCCTTCTTGCCCACTAGTTTGTTATCGT
GCGTTCAAATTTTCACAGCTCTTTGCTGTAACTTCCATGATGTTTCGTCGCCGCTTGTACTTCGCCAGGTGTTCAAGTATTTCAGTAAGCCTCGTGCGCG
GTTGGAAGGCCAATTGATTATCACAAAAAGTGTTCGCCGTCCATTGCCACCAGCGGAATACTATTGCGAGATCACAAGCGACTCCGATCGTATACAATGC
ACGCGTTCGTTCGCCTATGAAGATGAGGAAGGTCGGTTGGTTGTGCCAGCGGAAACAGTTGGTGCCATCTTGCGCTCTGGTGATGAAATGCAGGTTGAAT
GGCTGATTGATGACAATCGTGACGAGAACAGTCCGTCATCTGTGTGGGACTTGTTGATGCGAAGCGCGGACAGTTTTGTGGCAGGGCTCCAATCTGGATC
GTTTGCCGACCTACATCGCACAAACGCTGAAGACGTGAGTTTGGTCACGGCGTTCTTCGAGTTCGTCGTGCAACTAGGCCAGCAGCATGATGGGGGACAG
TTTATATTGGGGGAGCTTGAGCGCCAGTGGGGTGAGGCGAGATTGCGCCGTTGGTGGCTTGATCATCAGCTCCCGTCTCCAGAGATTCATGTGGGTCAGC
TCTTGAGGCAGCAAGTTTCGTTGCTAATGCTGCTTAGAGCGTCAAGAGAAAATCTGGTATCGTGGGGTATTCGTGACCGCTACACCCGTGAGCAAATTTT
GGCGAACCTTGGTGACACTGGAGGTACCGATTTTGGGAGCTTTCATGTTGATAGGAGCAACTCACCCAACAGTTCCAATCCGTTAGGCGTGGACGGAGGT
GTTCATTTGCTCCGCTTGTTGTTGGGAGTGCTAGATGGTTTTATACATGCCTCCCCTGGAGCAGCAATTGATGAAACGATGATGGATGGAGAGAGCACAT
GGTCTTGGGAGCAACTTCGCTTAGTCACAGCTTCCTTGATTGCCCTTCGAACGCTGTTGGCGACACCTGCAGGCGTGGATTTACTAATGAATTCTTCTCT
TGGTGGTGGACAAGAAGAGTGCGTTAACGTAATCGTGAAAAGCGCCAAAAGACTTTTTGAGCTGCAAGAGCGAATTACTGGCAAGTATCCAGTCGTTTTA
GCGACACAGGATATTTTCATGAGTGTGGTGAGATGGTTTCTTTCTAAGGAAGCGCAAACACTTGCGAAACCTTACAGTTCTGAGACCGACGGGTATCATA
CATTTATTGCCACAGAGAGGCTCTGGCTTGTTGGTGCTGCGGAGTTTGCGATCGAAGTATTATCCACACATGAAAGTTGGAAGTTTATATCCACCTCTGA
TCGATGCGAAGTCACTGAACGTTGTTTCCGTTTGCTGTATGTGCTTGTGCTTCCGCGCAAATACGTTAACGAGCGGAACGATATGGTGCCAGCGTTTGAG
GTGGCTCTACGTGAAACGTTATCGTCGGATATGTCACTCCTCATGAAGTTGCTGCGTTCATCCTGCGCGGTCCTTTCATCGCTGGAGGGTCACATGGGCA
ACTGGAATAGTATCGCCATGCCCGACAATGAGGAAGATGATGACTCATCCGCCAAGGGTGACAATGGTGGCCAATTTCCTCTTGTGTACGAAACCGAAGT
CGACAGTGCTGGTGTGAATCTTGTACAACTTGAATCCCTTGTAACGACGTGTTTGCGATTCTTGGCGTTGCTTGTTGGAAGCCAAACTGCGTCTGTGGAT
GCACAAGTTGCTCGGAAAATTTTGTTAACGCCTATTGATGATGGGGGACCGAAGAAGCGCAAATCACTGACAATTGTTACGCTATGTGGCGGATACCTCG
GATATTCAGTGGAAAACACACCTGAAATCGCGTACTGGTCTTTGCAGCTCCTACAACAAGCAGCAATCGTGCTGGATTATCGTCTGGAACGAGAAAGTCG
TGATCTGTCCTCGATGCATACCCTCGTCGCTCTCTTCCATGGATATCAAGATCTTCCTCTCGTCCGTGGGATGTTTTCGCGTCTGTTGCGAGTATCGTCA
CCACGGCACCACACGTTGCGAAAAGAGGTTATTGAGATGCTGACCTTGTGCCTTGAGCACCAGCCAGGCTTTTTGGCTCTTCTTCTGTTCGGCAATGATC
GAAAGGACGGATCATCCGCAAGCGACACTAGACATGATAAATCCAAGGACGATCCTTTGCCATTCGTGGCATTGCTGGAGAAGTTTTTCGTGGCGTCAGA
ACAGCTTTTGGAGCAGTCCTCTGATCTCTTCTGTGCATTGTTGACTTTTCTTGTTCAAGTTTGGAAGGGTGCCATCCACAACGGCCTTGGTGTTCACCTG
AAAATCATGGCGGCTGTACGTGAGCGTTCCTCCTTCTGGCCCAATGTGACACGGGCACTCAAAATCCATATGCCGGTGGAGTCTATAGAGGAACGTGGAC
TGCTGGACATGGAGTTAGCTGCGGCTACTATTCAAGGCACAGGTGATGTGGAGAGTCCATCAGAGGCGTACACCGGTCGCTCTAGTGCGTACGGGTATCT
AGCGCGGGGTTTGATCCTTCAATTGGTGTCACATGAGTGGCACAACAAGGCCTCTAAACAGAGTGATCACCCATTGGTTGACGTGCTGGAATCCTTCAGG
AAAGAGGGACTGTATTCGCATTGGCTGCGTACGTTCACGCGGTTAGACTATTCTCCGGCACAATTGGAGCAGCACGCATCGTCTATTCGACGTGCTTGCA
ATATAAACACACCCACCTCGAATCTACTAGGCGATATGCCGATCGGTGGTATCTCTCTGTACATCGAAGGACTCATTTGTGACGCAAGCACACTTAAATG
GCAACTCAGTGCGGGAGGAGACATCAAAATACATACTTCTCCGGCGGATATTCGAGCGCTGAAGTTGGTGCAGTGGGGCAATTTGCAAGCAGCCTATCTT
CATGCCCAGCTTTTCTCGTTAGCAAAGTGGAAAGTGTTTATGGAGTTATGCAGCTTACAGGCTGGTATCTCGGCCGATTCTAGTGAGAAGGTCAGTGAAT
CGACCACACCGAGACGGCTTAAACGGAAAGAATCGATGATCTCATCACCTCCTCGCAGCAGTGTGATGAGTAGCACGGGTAGTGCGGGCAGTTCTTCAAG
AATGCGGTTAACGGGACCATCGTCTACTGCATCTAGCTCGGACAGTGCGTTAGCTTCCTCACGCTTTTCCGGGGATCGCACGTCGTTTGGAATGATCCAG
GTGCTCGCGGATGTCATCAAGGCTAGAGTTGCCCAGCACGAAAACCAAGACGAAGTGCTCGACTATTTTGTGCTGTTGCACCTCCACGACCTCGTGCAGC
TCTTTGTATCGATGTTACACCATCAACTGTGCCTAGTTGTGCGCAAAACGCGCGACCCCAAGTTGTCTCAGACACGTCAGCGTC