Description :
From Genome Similarity Track
Location :
Scaffold_97:56194- 57869
Transcript NameFunction/comments
Phypa_INRA-310PPTG_18930hypothetical protein

Sequence
1675 bases(100 bases per row)
AGTCACCTGCAACATAGCAGGCTATGTTGACGACCTTTGCACCAGCACTCGTCAGCAAGCTTAAATCAGCCCTGGAAAAGAAAATTTTAATGGCAGATTT
AGGGGAGATGAAGTACTTACTCGATTGGTCTATTCAACGAGTCCGTAAGAACCGAACGATCTTTATCCACCAACACAAGTACGCTACCAAGGTCATTGAT
CGCTTCAGCAACTACATTCCATACCCTATTGCAACCCCAGCATAACGGAACGTTAAACTCTCCATAAGCAGCCAACCTGTCAGTGAGGCAGAGAAAGGTG
CGATGAATAACATTCCATACCGCAAAGCTATTGGTAGTGCTATGTATCCCATGGTAGGAACGCGACCTGACATGGTATTTTACATGCGTGAGCTCAGTCA
ATTTCTAGCTAATCCAGGAATGGAGCACTGGAAAGCAGCCGTAAGAGGTATCAAGTATTTATCGGGAGCCAAGAACTTTGGTCTTCTTCTTGGTGGAGCG
CTTGATATCACAACAGAGAATTTACGTAACAAGCTGATCGCCTACAGTGACTCTGGCTATGCCAATTGTCCTGATACGAGGCGCTCCGTCTGCGGATATG
TGACGATGTTATCAGTATTACAATGTCGTGGCTTTCGCGCAAGCACCACACTGTGGTTCTATCTGCGACTGAGGCAGAATACATTGCATTATACCACTGC
ATGCATGAGATGCCATTTCTTAAACTCCTCCTCCAAGAGTTAGGCTTTGCCACAACGCAAGCCAATACTATTTACGGGGGTAACCAGAGCTGCATCAAAA
TCTGTTACAACCCCGAACATCACGGAAGGTCAAAACACATTCATGTCAGATACTGTTTTATACAGGAGAAGGTGAAACGGCACGAATTTAACATCGCCTT
TTACAACATCGAGTCAATGATAGCTGACATCTTTCCAAAGCATTAGACAAACGCCAGTTCCGTGAACTAAGGACCAAGCTCACGATACAAGCCTTGAAGC
CCAACCTGGTCATTCCGTATAATGTACGAGTATAACATCAATGCATGAAGCATACTTCTCAAACGCGTTCTTTTTATCACTGGGTTTATAGTTTAATGCT
AAAGGTTTTCCCTCAGTGACGTTCTTCGGTCAAGTACTGAATTTAAGAGGCATAAGTACTAGTTTCAATGCACAAAGACGCATGCTTGCTGGAAAAGTTC
ATTGTCAGTTAGGCAAGCCCGCGGAAATCCTACTGACTCTTATCATCTACTCCTGCTTGAAGACAATGGATGGACGAATAAAAACATAGAAATCAATCCA
GTCCTCCGCTGACTCAATCGGCTTACCTTCTTCCAAATTGTAGATAAAGCCGGTTCTTGTCCTGAGCTGCGAGAACGAAAGCGTGACCGACGTTTTGATG
GTTGTAAGCTGCAACACCATACACTCCATCCTTGATTGATCTTCCAAAGCCCACCCACGCCACGCCGTCCAGCAACCGCGGAATTGTCCAAAGCAATAAC
AATGTAGATGAAATCACGCCCAGCATCACGTAGACGACGCAAGAAGACGATAACGCCCTTCCACGATGTGCCATGTGTTAATTCCTCTCCACAAGAAGTC
TCCTGATGCTCCACAAAGTCGTCAATGTCCTGTTGCTTCACTATATCAGGGCGTCCAGCTAATTCCGCTGCACAT