Description :
From Genome Similarity Track
Location :
Scaffold_419:56184- 62150
Transcript NameFunction/comments
Aphin_H310_00849beta-glucosidase

Sequence
5966 bases(100 bases per row)
TTCAAGCTCACGTATGGCCAATGCACAACGGATTTTCTCGCCGTCGACATCTCGGCAGCGGATTTGTCTGAAGCTTTAGCCAGCTTGACGTGTTTGCGAA
GCGTCCAGGTCGTGCGTTCTGGACTAACGTCCGGAGGCTACCAGTGGAGCATTTCGTTTGTCACGGAAACTCCCAACGGAATTGTGTTTTCCGTCGGTGC
CAACGACTTGTCGTCACCGAACTTGGCATTCGATGTCGGAGCCAATCTCGACCCTGCACACGTTGGAGCCTCCTCCATCACGGCAGGAGTGACACAAGAT
TCCACCACGGTCACGTCTGTCGGCATCCAGACGAGTGCCGTTTCCGGCATGTACTTGCAAATCGCGGGCGTTGTGTACAAAATTGCATCTGTCGCAACAA
ACCAAGTGACTTTGGCGTCTCCGTACCGTGGTGCGACCAGTGCCAGCCTCACTGCCGTGCTTGGCACAACAGTGCCAGGCGTGGCGCCACCAACGCTTCA
GAGTGTCGAAGTCCCGGCCGACATCAACGCCACAGGACCGTTCTCCTACCATATTTCAAATTTACGACCAGGGATCCCCTACGTCGCGCGTGTGTCGTGC
TATAACAACCGAGGATACAACGCTCCAACACTGTCTCAACCGACCGCTCCGCCGCAGCAACCTCCGTCCAGGCCCCTGCAAGTCAAGGTTGTCACTGGGT
CAGCGTCGACATTGACGGTGTACTGGTCGCACCCTCAAAGCGATGGCGGGAATGCCATTTCCAAGTACCGCATCGAATGGGACACCAAGCCAACGTTCAA
TGCAGGACTGGATGGCGGATCCCTCGGGTCCGACATTGTGTCGGTCGTGGTCCCTGGCGTGGATTGCGTGTTGACGCCTTGCCAGTCCATCGTTGGGAGT
TTGGTCAAGGGCACGCCATACTACGTACGCATTTACGCGTACAATACATTTGGGTACTCTAGCGACGCCGGCGTCCCGTCGCCGCTGTCGACGATTCCTC
AAACGTTTGCAACGCCGCCGTCGTTGGTGCAGTTGAGTCCTGGCGACAACGCAACGCTGGTCGTTTCGTTCTCTACGCAGCACGACAACGGTGGGGCACC
GATCACAAAGTACAAGATTGAATGGGACTGCATGGATCAAAGCGCGATCGCTGCGACGCCGGGTCTCGTCACGTCCGACTTGCTCTACGTTCGACAGGCG
GTTCAGCGAATTCTTGTCTCTGCGTCAGCATTTGATTTGGGCGGGACCTTCCGTCTTGGCTTTGGGGGTGCGGTCACCCCCTGGCTCGCCTACGATATGA
CTGCCTCACGTATGCAGCAAACGCTTGAAAGTCTCGACACAATTGGGTCGGTACGCGTCCAACGCAATGCAGTCGGCAACGGATTCGAGTGGCTCGTGAC
CTTCCTGACAAATCGGGAGAACCTTGCGCACAATGGCGACATTCCGGTTCTCGTGGCGTCGATCTTGACCACTGAAAACTACGCAACATTTGACGTGACA
AAAACCACAGGAGTTGGAGCGACTTTGACGGGGACGGGTGCGGCCATCTCGATCTCGACCAACGTTGCAGGATACAACGGTTTTGAAGAGCAGAGCGTGA
TTGTGGCCACGAATGCTGGAAACCTCCAAGGCACATTCACGCTGACGTTCGATGGCCAAACGACCCTTCCACTTCCGTACGACGCGACGTCGTTGGCTGT
CAAGTCATCGCTCGAAGCCTTGGGGAACACAGGCACCGTTTGGGTCACTCGTTTTGCTAGCGGTTTGGGCATTACTTGGAACATTATGTTTTTGACCCGA
CTCGGAAGTGTTCCGCTCATCGTTGTCGGCAGCACTGGCCTGTACTCGTCCAATCCAACGGCCGCCGTGTCCGTAAATGTACTGGAAGTGCCAGGACGAC
TGCCAGCCATGAGCAGCTCGTTGTACGGTGCGCAAGTTGTCACGGTGTCACCTGACGCGTTGCAGCCACGGGTAGAGTACAAGATCCCGTCATTGCTTGT
TGGTGCGTTCTACTTTGTGCGCGTGTCGGCATGGAATGGGTTTCAAAACGCGTTTGGCAGTGCTCAGTACAGCACGCCGCCAATCGAAGCCCCTCAATGG
CCACCCGGGCCGCCGCAAAACTTGGTTGTGGAAGCAAACTCGACGTCGACCTTGGCTGTGTCGTGGGCGCCCCCGTTGTTTGACGGTGGATCCATTATTC
AAGGGTACACTGTGGAATGGGACACAACTCCAGGGGTGTACGAAGTGCAATCCGTTGTTGTGAATGCGACCGGAGCGGTGTCTGGGTCCTTCACGTTGGC
TTTTCGAAAGTACCGCACAACAAATATACCATGGGACGCCACGGCCGATATGGTGGCTGATGCACTCAATGCACTGCCGAGTGTGGCTGGTGTTAGCGTC
ACCCGTGGAGCTCTTGTCTCGTTTGGGTACGCTTGGACAGTCACGTTCAACGCAAACCCTGGAAATTTGCCGCTTCTATCGGTGCAATCGTCTAGTTTGG
TAGGTCCCGCAGTATCTGCCACCGTTGCCGAGATCACTGCCGGAACGAATCCGCCATTCAGCCCCCTCACCAAAGGCAGCATCGTTGTGGAGTCTCAAGC
TGAAGTGCAAGAAGTGTTTGCCCATGCAGGTGCTGCAGATCTAGGGGGAACGTTCAACTTGGTTTTTTCAGGTGAAAGTTCGGTCGACATTCCCTTTGAC
GCTTCCGCCGACGTTGTGGCCAAAGCGTTGCATGGCATGTCAACGGTCTCGGCAGTCACAGTGACGACCACCGACGAGACGCAGTCGTCGATTTTGGCTC
GGCAAACGTATGGTCGGAAGTGGCGCATCTCGTTTTCCAGGTCGGATGGAAACGTGCCGTTGCTACTGGCTACGACTGTGGCTGGTCGAATCCCCCGACG
GCTTGCGTGTGGTGGCTCATTGACCGGAACGACGCCGTGTGTGTCCATTCGACAGGTGGTTCAGGGAGGCATTCCCGTCCAGTACATAATCCCCCAACTC
CGCACTGGGACTCCGTACTTCGTTCGAGTCCAAACCCAGACACGTTTCAGTACGAGTGCGTTTCAGTTGAATGCGTTCAACGTCGCTCCACAACTCGTCG
CCCCGTGGCCAGTGCTCAACGCTGAGGCATCAATATTATCCAGCACTCAACTTGCCGTTGCGTGGGACGCCCCTCCTGACGCGACAATCGCAAACTACAA
GCTGCAATGGGACGTGTCGCCGTCGTTTGGAATGACTTCGACCACTTCTGGATCGGCCACAATTCAAGCCGTGTCTCAAAAACCTCGATACACTTACGCA
ATTTCGGGCCTCTTGGCAGCCAACTCTTACTACGTGCGTGTCATGTCGTACAGCGCTGGGGGCTTCAGTGACCCGACGACGGCAGTTCCATACTACGCCA
ACAATCGCGTCACGCGGGTGGTCGTGAGCCACGCCAATATCAACGGCATCCTCGCGGCAGCGATCCAAACGTTCACGTTTACGTTTGCCAATTATGCCAC
GGCAACTTCTGCTGTACCGATCAACGCCCGTGCCGACCAGATCCAAGCGGCGCTGCAGTCGCTTGTGCACGTTGGCGCGGTGTTTGTGACCCGGCGCGAT
CACTCCACTGGGCCGTTGCTCGCGACTGTCGATGCCACGGGTGTCGACACGGACGGTTTCCGCATCGAGTGGTTCATAACATTTGCCACATCGTCCGTGG
ACAATATCGCGCCAAGTTCTCTCGGCGCCTTGTCTGTCATGGTGTCAGCGGGAGTCGTTGCTGCTACAGACTTCAACATTGCCGACGTTGTGGCTGGGAG
CGACCCGTTGCCGCTCTCAATGACCCCACGCGCCGCGGCACCTGATGTTCCACTCAGTGTCACAGTGACGGTGGTGTCCAGTACGACCTTGGGCGTGCAG
TGGCGGCCTCCGCAATACGTCACTGGCATCACGAAGTATTTGATCGAATGGGATTTGGACTATCAGATCATGTCTCCCGTTCAAGTCGGCACCACTTTCA
CCAATGCTCATGCGTTTAGTGCGGTTGTGGACGGGTCGACCACGAGCTTTTTGATCCCTGGTCTCACAACAGGTGCCACGTACTACGTTCGCGTGTCTGC
TTACAACGGACAAATTGCCCCGTCCGCCAAGGGCTACAGCTCAGCAGTCGTCGCGACCGGTAGCCCAATCGTTCCAACGGCGCAAAGTCCATACAAACCC
ACGAATGTTGCTGTGACTGTGAGTCCGCTCAACATTGCGACGCAGTTGGATTTGTCGTGGAAGGAGCCAACACTGAATGCCTTGGGTTTTGCGCAAGGTG
ACGGCGGCGCATCGATCAAGGCGTACATCGTGGATGTCAGTACGCAGTCAGAATTCGCAACATTTCAGTCGTATCCTGTTAGTACGTACGATGGTGCTGG
AGCTGTGACATCCTGCGCAACGACCGCGTGCCACTTTCCCATTGGCATTGAAGTCCAAACGTTAGTCGTTGCCGCGACGGCTGGGACATTCCAGTTGGTC
CATACGTCGACTTACCCCTTGTCCCTTTGCGCTGCTTGCACCGTGACTCTGGACCCTGTTCTGAATCAAATTACGTACAACGGCCCGGACCTGCGTTCTC
AACTAGGCACAAACGTCAAGTTTATCGTCGACAAGGCTGGCGCTGCGTGTGCATTCACGGTGGCGGCGGTCGCCGTGTCTCAAGCCAATGTTGTCAAGGT
GCTGCCTGGGTTTTCATGTACGCTGACAACTGGCACGTTTTCCATCCACGCGCAGCCGACAACGGCGTGCTTGGCATCATCGACGCTAACAAGCGCAGCG
CTGGAAACCGCCCTCACATCACTGACGAACATCGATGCGGTTGTTGTTACAAAAGAACCTGGGCCTGCGTTCGGTGCGACCATGTACCGCATAACGTTCA
CCGGCGCCCTTGTCACGGGCAATGTGCCTCAGCTGCAAGTAGCTTCCGTGGATGGCTCTGGTGGCTGCACAGCGCTCACTGGAACTGTTTGGTCGGGAAC
TGCGATTGAAGGAGGAACTTTGGTCCCTGGCGGGTCGTATTTCGTTCGCGTGTCGGCTCAAAATGATGTCGGGACTGGTGTACCTGAAGTTGCAATGCCC
ACGCTTTGCCCCGGCGGGTGCCCTGCAGACAAATCCATTGTCCCTGTCGCGCGGCCTCCCCCTCCAACAAACGTGCTCGTGTTTGCCAAACCAACGGATC
GTTCGGTGCTGCGGCTGACTTGGAGCCCTCCGACGACTACGAATGGTTCACCTGTTTTGGCATACTTTATCGAGTACTCTGTGGACAGTTTTGCCACGTC
TGACGTGTGTGGCGCGTGCGTGACAGCGCTGGCGTCGAATGTGCTGACGATCAATGCCCAAGTCACGACACTTCAGGTGGGAGACATGTTCCGCCTGGAA
CGCCCCGTTCCGTGTATCATGGTGGTGGCGGCCGTCCCGACGTGGAATGGAGCCACAGGAACAGTACCAGTTCAGCCCAACCATGGTTGCTTGGGCTTCA
CAGGTCAAACAGTGTTCATGACCGACCTGCATGGCGCAGGTAGTGGACTTGTACAAGTGCCAGTAGACACGTTGACCACGCCCTTTTCTGTCGAAGTCAC
CGCGGCGCCAAACACTGCGTACAAAGTTCAAATGCGCGCGGTCAACGTGATTGGCGTTGGTATTGCAGTTGCGGCAACTCCCACTTGCGACAACACCGTC
GTCCAGTGTGTGGCTTCGCCTGGGGCGAACGTCATTGTGACAAGGCAGCTGCCGGCCGCTCCGACCCTGCTCTTGCCAATGCAGTTGGTATCTGGCAGCG
GCAACGCGAATGGTTTCACTCAAAACACGCTCGACGTCCTCGTCCGCGATTCCTCGTACTGGCATGGCCTTGAAGCAGTCGACAGGTTCCTTGTTGAATG
GGACACCACGTCAACGTTTGATTCGACCAACAAGGGAAGCGTCACGCTACAAGCCACTGGGCCGAC