Description :
From Genome Similarity Track
Location :
Scaffold_82:5618- 6876
Transcript NameFunction/comments
Phyca_LT1534129281putative retroelement pol polyprotein

Sequence
1258 bases(100 bases per row)
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnggggcagcgcgttggcacttgctggtcaaagccacaagagaaaggcaagtcggctgccaagaccaagaaacc
gcttcgcaagcagatcccggtagaagactgtctaccgaaaccggtgaatgcgtgcgagacggcgcagccaggcgctccggtgagtccaccgccagtcagc
ccaccaaccaccatgacgcccggctacgaagatttgcacggcaccgagccaatggacaccgacgagtccatgtcgtcgttcgaagtgcctgtcaatgctg
gagacgtcactggagatggggcgattaccgacatggcggcaggtgtcaacaagatggcatggagcaagcggtaagatctatgtatccctttctgcttgac
agtgaaacacttctgatcactgactgttgggtgcttgattcaggatgcggtttcggtttaaccagcgaagcatcccggtttgtggagatgagacccgaca
acggctacatgtttacatttgcagaagggtctaaacatacaaatacacacattggcac