Description :
From Genome Similarity Track
Location :
Scaffold_431:5617- 14113
Transcript NameFunction/comments
Phyag_g5650hypothetical protein
Phyag_g5651hypothetical protein
Phyag_g5652hypothetical protein PHYSODRAFT_493974
Phyag_g5653conserved hypothetical protein
Phyag_g5654hypothetical protein

Sequence
8496 bases(100 bases per row)
CGTGGCAAAGTTGAGCACCCGCCACTCGACAAGCAACTAAGTCGCCATGTTCAATGAATTCTTCAGACTGAGATGGGCCCACCTGGTTGTCGTGGGTGAT
GTTGTACGATGTAGACGACACCACTGGAGGGAGGGATACCGTTGCCACGGCCTCAGTGATGGCAAAAAGCACCGTGCTGACTGCAACACTACCAGAAAAC
ACACCACGTAGTACCGAGTCATATTGTTCGTAAAGTGCGCCACCCgcaccatcgtcaccatcaCCAACTGCATTAGGGATCGCAATAAACTTAGTAGACG
CTACCCAGTCCTTGAACGCAAATTTTTGCGCAGCAATCGTCTCTAGAGTGTTGATTgtctcgttctccagctcttcagctCGCTTGGTCCCTGAAGATTC
CGTACTGCAGACCACATTTGTGAAAGTAAAGTCACTCCACTCGATACCCCCCACTTGGGCAGCCTCATGGAAGACCTTTACGACAGCGTTTGCAGTCTGA
AACACTGACACCTCTACTGATCCACCTCCATCCACATTCACATCAAACCTACTTACATTTGATCCTCTTCGGTTTTGGGCCCGAACTTTAGAGATAGCAG
GGGGGTTAGCTAGAAGCACCACCCCGTCAATTAGCGGTAAAAGTGGCAACTTCTCTGGTCCGTCCGTCACTTGAGACGCACAGCCCTCCTCCCCCAGTCG
TAACAACGCATCTATCTCCAGTAGAGAGGAAGGATAATCCACCAACAGGTACACACGTGCAGGTGTCTGAGTAGGGTCAGTCGATTTCTTCTCGTCTTTG
TCCTCTGTACGAGTCTGCACTTGAATTTCTTCTCCTCCCTCTTCTGCAACGGCTGCAGCTGTCTGTTGATGTGCCAGAAATTCTTGCTTGTCTTGACCca
cgagacgctggaaggccagcgccaacagcaatggtgtcgctgcaacttgcgccGCTCGTTccttttcttcctccttctctaCTGCAACTACAGCAACCGC
GACATCACCTTCGTCTGCTCTCTCCGCTCTGGTAGCCTCTTCCAGCACTTTCTCCTCGCGTCGCTTGGCCTCCACGTCTGCTCGcgcgatctcctccaac
tccgCTCGACCCACGACGCGAtacgagcagctccgttgCCAGCTCGTGAGCTCTGCACTCTCCCGAACTCTATTGAGAAACTCCCTCttggccgccagct
ccttctccgccgcgCCACTGGTCAGCGCCACTGCGTGGAAGCCCCACATGGCGGCGTTTCAAGGTCTCCCATTTTTGAaccatacaaactccaagttTAA
CAAAAATTGTCTCTCAGATCCAGGATCGGACGGCATGCGACTcgcgctcttgctgctcgctgtGTGTGCACTTGCTTTGGCCGCAGCGTCAGCGACTGCT
CCTTGTGACGAGAGGAAACTGGAGCGAGACGCTGTGGCGGTCCTGACAGCgaacgtggacgtggagTTGGGCGCCGTCGGGGCGGGCAAGCGCGACGTCG
TGGGCTTCCAGTATCTGGTACAGTAATAAAAGCACTTCAACCGTAGCAAACACCCCCTAACATATTGACTCGATATGCCGTAGAAACCAGCAGAAGCGCT
CTTGGCAGCTCAAGCGTTGGCCCATGAAGATTTCAATCAGGCAGCGACGCAGGTTCAGCGCGTCCTCAAGTACCAAAAGCCCCACGGACTCCTGCCACAT
CTGGTCTACGGTTCGTCTGTGCCGTCCAAACTACGATGGATACCCAGCAACCGCACTTTCCACCCAGGACCGGCATTCTGGCGGCAGACACCGTCAGCAA
AGGAGACTTCATTGGCGTCATTAAACACTTCCACAATCTCAGCTCCGCCGGTGGCTGCTGACGTGGTCTGGGAGATCTATCGCTTGGCGCCATACGACTC
GGTGCTTGGTGCGAAAACAACTGCTGTGAAATTTCTCTGTGGAGTCTACGAGCCACTTaaaaagctgcagaagcactTGTTCTCCACTCGCCGCGGCCCC
GGTCCCAGTGGTTTGTTGACTGCTCGTGTACGTATTGGCTGCTGCATGATTCCGCACGTATGATCGAAAAGAGACTGACATTTGCCCGATAACCATGTTG
CAGCACCCTTGGGAGACATTTTCGTCGCTATCGCCGCACTGGAAAGGGTTTCTAGCCAAATTGAAGAATGCACCGGATTATGTGGAATTTGTTAGCTCTA
TTCCAACGGAAGCTCGAACTCGCTTTGCAACCGGAGCGAGCTCTATATTCTCAGCCGAGGACGCAGTGGAGAATCTATACGAACCGATGGTATATCTCGC
AGCGCATGCTCATCTCGGCGGGGGAGGCAACGATATCTACAGTCGCGAATCAGCTATGTTAGAGTCCTTCACCTATGGTGTGACCGACGGCGAGGCTGCT
CGATTTGGGGTCGAGGATGTGGAGTTTAATGCACTTATGCTGCGATCATCGCTGGGCCTTGTGAACATTGGACGTGTACTTGTTGAACACTCATCCGAGT
GCACGGGGTTCACTCTAACGCAAAAAGAACTTCTGGCCGATGTGGAAGAATTTCGCTCTTTGACGAAAGGACTCGAGAGAGCTCTCATTGGCAGTAATAA
CACTCAGGGTCTGTGGAACGCATCCGATGATTTTTTCGCCGACTCGAGTAGATTGTCATTGACTGCAGTTCACTCGTTACGCGGATTCCTACCTGGATAT
GCTGCGGAACTGGATGATGCCAAGAAAATGCGCTCGATGAAGCATTTTCTTTCGGAGCCCGGCTCGTTTTCTTTCTTTTGCTCTCAGTTCCCCGCTTCGT
TCTTCGCCTGCGCTGAGGAAGAGtcggttgaagctgctggatcgATAGATCGCCGCCCAGCTACTACAACATGGATCCTCTACAACTACTTCTTGCAGCG
GGGGTTTGCTAGGGTACGTTTAATGGGTACTTATTTTTTTTACGATGAAAACATTGGCGCTAATAACGTGGTGATGCTCAGAACAAGTTTCCAGGGCTGG
CTGATTACATTCGCAACAAGACAAGGGACATGGTATGCGAGGCTACAACACCTATTCAATTATCTTTTTCGTGGTTCCCGCTCTCACTGACGGCGGAGAA
ATCGCCACCTACAGCGCTTGCGCCAGCATACGATTCTCGCAACGCCACGCCAATCCAAGTATTTGACGATGGTTACTTGGGGTCAACtttagctgctgcc
actcTTCTAAACGTTTTGCTGCCAGCAGGTATTCTCATAAAGCCATTCAGTGCAATTTCTGCGAGCTCACTCTGCCTATGTGTTCTTGTTGCAATAGTGA
CCCCAACACCAAGCCCAGATACGCCACCTATTGACCATCGTATTCTCTCTGTCATTATGTGCGTCGAGTTAGTGGTTGCCTTTGGTGTCGCCATGAGCTG
TTTCCTGTTTTCAGTGTATTTTGTAGCGAATCGACCCCGAGACACTCGATTATCTCCTGGTTCTGCAGCCCGCCGTCGGTCATCAGCTGGTGTCGCTGGA
AAGAAACCTCGAGACATGGAATTGGAGGATCGTGGACGATTAAGTGCCAGCGGAACAGCGTGGGCAGACAGATATTCGGAGTCGTCGTACAGTGACTATT
CTCCTCGCTCTGGGCACGCACCGTATGAACTGGAGGAGTCGTTGATTTCGGAGGGAGACGAGCATTATGGTTCCTTTAACGAGGCAGAGCAGCCGCAGAC
TCCATCCAATTCAGCGTGGAAAGCGGCGAAGAACGCGCTAGCTGCCATCAGCCCCTGGTAAGTGACGATAGACAATCACTTAAATTCATTGGTAGCGTGT
ACGTTGCGGTCCTTCATAATATTTCGCCAAACCTTAATGCGTGCCTACAGCAAGTCCTTCTTCCATTTTGCCACAAGTTGCGTGGCTGCCTTAGCCACAG
AGGCTGTAGTGTGCTTACGCAGTTTGTTGATAGTGCGCCCGACACCCGTGCTCTTTAGAATATCAACAGTGAGCTCCATCTCTGCCAGCGTACTCAACAC
GTGTGTAGCCAGCGCAGTTGAAACATTCTTCACGTTTCCGTTTTGATCCAGTAGCCTTTGCAGGAAGGCTGCACGAGTCGCCACGTCTTCGTTTTCATGC
GGAGCAGCCGcagtcgccgccgccacctcggAGTCAGCATTCGTACCGTTGCTATCGCTCGTTCTACTACTTGAAGATCCCTTGGACTCATCGGTGGGGA
CATCCTGCACAGAGCCAAAGGGTCAGAATTTGTCTATAGCAGATCATCCACTAGAATCGTATCGTATCTTACATCAACGATGCCAAGGTCTGCATTTAAG
TGCAGCTCCAAAATAGAGGTTGCCTCCGGAAAAGCTGGTGCGAATCCCACTCGGTGAGGCTCGCACAATGCCCACAGCGCTTGCATAGTTGCAAAATACC
GCTGGTTGGCATCATTTTGAGCCGACTCTGTCACCCAAGATCCATCCTCGTGTTGAGTCAGCAACAGGAAGGCTATCCCACGGCGCATCTGAACGAGATT
ATGTGAGCCTTCAAAGCATCGCAAAGCCTACATGCCACACAAATCAGGTCAGTGAGCCGATACGCTACAACTGTTCTCTCTACTACTTACCCATAAAGTC
TCTCCGAGCAAAGCCACATCTTGCTGCGCCAAGTGATAAACAACATGATGCCGCAGGAACAAGTACtcatgaggaagaagattcTGTTGATGTGGGGTAA
GAACGCGTTAGTACTCGACAATGGGGAATAGTAAGATACGTTGAAACGAGTCAGGCACCGTCTTACCGTCTCGCAGCGCAGTCTTCTTTGGTTTGTGAGC
ACACGCACCAGGGTGGCGACAAAGTGCACTTGGTCTTCGTACTCCTGAGGCGAAAGATCACCGGGGCCCTTGTATGGGTACACAGACAGCaggtgttgca
gcagctgcggcagcgtGAATCCGATCGAGATCCCGAGCGCGCGCGAGTGGTGCCACAGAACCAAAGCACTCGTAAGTCGCTCGTAGATTGAGGgtccgct
gtcgtcgtcggaaggtggaggaggacccTCTGCAGGATTCCATCCCAGAAGCTCCTAcacaacgacggcaacacAAAGGTGAGCTACCTACATTCATCGT
CTTCTACATTAGAGCATCTCTCACTCACATTAGGCCCATAGACAGCAGGGGATCGATCGCAAAACTCCAACAGCTCAACACGCCTCGGATGGGAGATTCC
CAGTCGTTCTACCACGTAAACGGCAGTAATCGCCTTGACGAGTTGTGCGGGTGTGGGGACGGATCCGATGGTCCAGTCTGCATGTCGGTCTTCTTTGAGC
CACAAAGCGCCCATGAGTCGGGCGTAGAGCGTCGAAAGTCGCAGCAcctctccttcctccaccgCCTGTAGGTCATAGAGCGACTGGGTGGCGTGCAGTC
CCCAGTCCGGGAAGGGCGCGGGGTCCtcacgcagcatcttgtaGACGCAGTTGAGGCCTCTGACGATACTCTCACGTCGCATGGTTATTTTCCAGGGCTC
AGGAGGCGCCCGTTTGGCCACTTTCTTGGCCTTGATCTTGCGCAGTTCCTGGTGCATCAGCCGCTTGAGCACGTCCTTGTGGTTCGTGAGACTCACGTGc
acttccttctccaccgcctgccgcaccagcttcgtcgtcagcttcgcCACGTCGTGGGACGCGATCACGCCCGCGATGGCCGCCGAgatcttggcctcca
gctccttggagATCGAGCGCGGGTTCACGATGAGCGACGAGCCCGTGGATGTCATCTTGGTGTACATACCCCCCGCCATGGACGCGAGCTAAAGCGACAA
TACGCCTCGGTTACACAAACTTGTATAACCAGGGTACACTATTTAGCCAATCACCGACCAGATTTTTATTGCCATACTTTTGCCAAGTGAACGCTTGTTT
GTGGCCTACACGAGCAACTCTCCTCCCCACGTGCAAGATGCTGGCCCGCGCTCTTCGATCGTCTGCGCTGCCGCGCGCCGCGGCGAGCCGCCGCTTCATC
GGCGGGTTCGCTGCCGAAGCGTCTGCTCCTACTGTGGCTGAGAAAGTGTGCGTCCTCCAGCCCAATCGATCATTTCATTGACAGGAAGAAGTTCATTTGT
GTCTAATATTCTGGTGGTCCTGTTGCTCTGTGCTGTCGTCCACTGCAGCGTGaacgtggtgctcgtggacTACGAAGGCAACCGCCACGTGGTCAAGGGT
CGTGCCGGCCAGACGCTTCGTCAGGCCTGCGAGATGAACAATGTAGGCTACGTCAAGGACGACTCCATGGGCGGCGGTGGCGTGTACGACGCCCATCGCG
CCGACTTCTACACTGAGTCACTCTTTGGCGAGGGCTCCACGTCTCCGCAGTCGCACGTCGTGGTGTCCAACGAGTGGATCGCCAAGCTGCCGACCCCCAA
CACGCAGGAGCGCCACATCATCGACACGTACGTCCCGGCCGAGGACCGCTCGGCCAACTCCCGTCTGGGCACAGAgatcgtgctgcagaaggagctggac
ggcCTCGTGGTGGCTGTGCCCGAGGCGCCCCCCGTCGAGGAGTACGAGTACGAACACGAGTATGACGAGGACGATTACGAGtcgtacgacgacgagcacc
aCCAAGCCTAAGTAAGGAGGGACGAAGGCAAGCGAGCGGAGACCATTACATCCACCACCATAACTAACAagcaacaaaaacaaaagaATACAAGAAAACC
AAACGCTTTCGACTCGTTTGTCTCCCCAATTTTCCTACTCCTTAATCTTCTTCTGAGcagctttcttcttctccagctcgagtttcgagtggttcttgat
gtctcgacgcttcttcaccatgTTCGAGTCCTTGTCTGCAATGGAGAGGTTCCGAACTCGACTCGGGGACTTGTCGAGGTCGCCGTCACTCTCTCCGTCG
CTGTAGTCTGTACTGTTATTGCCAATATCATTGcgctcatcttcatcgtcttcgcccTCCACctcgtggtcgtcgtcgccaaacTCCACGTCCGTATACG
GATTCATCTGCCGCTTCTCGGTGCGCGACACACGAATATTGTAGCGCACCTTATCATCATCACTACGTGTGTTCGACGGTAGCCCCACAGAATCCCCGGG
CTGTCCCATGAGGTTGACCATCCTAGTGCTGTTCTTGTGGCGAAAACTGGGGCTAGGCGCCGCCTGCAAGTGCGCTTCATCCCCGAGCACAACGcgcacc
accttctcgatCGAATCCACAAGCTCCAAAGCATTCAACTGCTGGATGGAGGCCACGCCCAAAAGCTGCGCGATGTGTAAGAGCCCCAGTTGAAGTTTTT
CATGCAAGGAGCGCAACCGTGTGGCAcgttccttcttcttctgcttgaccGCGTTTGCATCAGCCAACTGTTTCTCCAACATTTTCCCATTGACGCTAGC
TTTGGAAGCTGCAACACCCTCATCTCCATTTGAGTTTGTtgcgtcctcctccaatgAGCCATCCACGTTCCCACTGGAAGTCCCGCTAAGCTTGATATTC
ACGAATTGAGTCTGAAGGAGCTCCAGTTTCTCGCGGTACTCGAGCACACGCTGCTCAGcctgcttctcttcctcctccagctgaaCCGAATGATCGAGCT
GGTTTTGCCAACAGAGCAATGCATCTTCTGGTTGGTTGATGCCTACTTGTCGGAGGGCGCCCAGTATCCCGTCATCTTTATAAGCACTTCCCAGGTACTG
TTGCAAACTCTCCGCGTTCTTTTGTCGGGCCAGCGAGGTCTCCTTCATATGGATTAGCTTGTCCTTCGCACGGAAGAAATTGGGGTCGACGGGTGATGCA
TCTTCTGTAGACAAGCTGACATTGGCACGGCTAATGAAGCCGACACTTGTACTGAGCACGGACATTTTCTTCTGCGGGGAACTGGTGGCCTTCAATCCTG
GTTGTCCACCATTTTTCGCCGAAAGACTAACGTAATACAGCCGACGATCGAGCTCTTGACGCCATCTCAGCCTTGACAATGCCTCTTGGTGAATTGAAGC
CTTGTCTTGCGTCACCTTCACCAGCTTCGGTACATCCAGACTCGCAAGTCGCTTCTCGTACGATACTACCTGTGCCTTCTGTTGCAACTCCACAATTTCG
CGCTTGAGTTTTGCTACGTTTGCTTCCGCGGTTTCGATTGTATTAGGATCTCGAGCAGCATTTAGTTCGCAGTGACGGAGGATTAATTTGTAGTAATCAC
TGCGCTGACGCCCAAGTGTAGCTTCGTTATTCACAGTGCGAATGCTTTCCAGTAGATCGTCAACGTGTGTGGCACTTTGCCCCGCTGCCGTGATTTCCGC
TTTGGCATCCATCACACGAGACTCAAGCGCTTTAAGAGCTTCGTTCTTCTCACGCACGACAAACTTCATCCTGTCGTACTTCGTGCGCAGCTCCATTAGT
TGACTCTGTCGCAGCAATGCAAAGGTATGTTAGATATCCTGCGGTACAATAGTTGCAACAACCAATCTGGCACGAACCTCCAGCTTTGAGACAGAG