Description :
From Genome Similarity Track
Location :
contig_42:561585- 562672
Transcript NameFunction/comments
g7785.t1hypothetical protein

Sequence
1087 bases(100 bases per row)
CACCGCGGGGTTGACCAAGGGGCACGACCTCTCCTCCGTGGGGCTCATGGAAACTGAGCAAGGCGCCAACTGGATCTCCACCTCGGGTAACACTACCACG
ATCGAGTCCATCCTAAGCGGAGGAGGCATGGACACCGTTCGGCTTCGGTATTTATTCACCTGAAAACTACTTCGGTAAGTACCAGCTACTAATCCTGTGA
ATGGTTCTGTACAGCATCTGGACGGACGGCGAGTACGATCTGGACTACACGTTGGCGCTGGCCCAGCGATTCTCCAAGGCCGGGTACAAGATCTACTTGG
ACATGCACTTCTCCGACACCTGGGCCGACCCAACCGACCAAGCCATCCCTTCGTCATGGGACGACAGCTCGGTCACAACTCTTGCCGCTGATCTGCAGGC
CTACGTGACGTCGACACTGAAGTCCTTCACGGACGGCGGAGTCGACCTCGACATCTTGTCGTTGGGCAACGAAATCACCGACGGATTCCTCTTCCCGACC
GGTCAAATCAACAATGACGACTTCAGTGCTTTGCTACGCTGTGGAAGGCTGCACGGCAGGGCGTGACAGACGCTGTATCGGCCGGCACGACCCAGCCCAA
GGTGATGATCCACCTCGATAATGGCTGGAAGTACGAGACCGTGTCGTGGTTCTTCGACGGTCTTTTCGCGGAGGGCACCGTGACTACCGACGACGTGGAC
GTGTTTGGCTTCTCATTCTACCCGTACTACAGCACGGACGCTACCATCGACGCCCTCACGTCTTCTCTGACTCAGTTGGCCAATTCGTACAGCAAGCCGA
TCTACGTGGCCGAGACGGACTGGCCGACGGAGTGCTCGAGCGTCACACTGAGTGGTGACTACCCAGTGAGCGCCAAGGGCCAACGCGAGTGGGTGATCGC
CATCATGGACGTCCTCGAGAGCTTGCCCAGCAGTTTGGGCGCTGGTATTTTCTACTGGGAACCAGCATATCTGACGGTGGCAGGTCTCGGAAGTTCTTGC
GAATCGGCGCTGCTTTTTAGCGTCAATTGGGACAACTGGCCGGAGACGTACGCGACTGCGCTTTCGTCGATCAACATGTTCTCGTGA