Description :
From Genome Similarity Track
Location :
Scaffold_95:56152- 58614
Transcript NameFunction/comments
Pytap_DAOMBR444snap-pag1_scaffold_95-abinit-gene-0.76Regulator of nonsense transcripts 2
Pytap_DAOMBR444maker-pag1_scaffold_95-snap-gene-0.22Type I inositol-3,4-bisphosphate 4-phosphatase

Sequence
2462 bases(100 bases per row)
GATGACGATGAAGATGGAGATGACGATGATGAAGATGAAGAAGAAGAGGAGGAGGAGGAAGAAGAGCAGCTAGTAATTCACGACCGTGTCCAAAAGACAG
AAGAAGATGAGGACTTCGAAAAGGCATTCAAGGCAATGATGAGCGGAGGTGGTGAAACACGCAAGGTTGTTGGTCGGGTCAACGTTGACAAGATGGTTAT
TCCGACAATGATCAGAGCTGCCACCCCcGCCCCTTCGGCACAGGCACCTGTTGGATCAGCAAACGAAGATGGAGCGAGTACTAGTGCCAGTGGAGTCGTT
TTCCGGATGCTTCGTAGAGGCAACAAAGGCAAAGTAGAGGCCCGTCATCTCGTCGTTCCGGAAGGAACATCTCTTGCCCAGCACAGTCAGCGCCAGGAGC
ATGCCGGAAAGAAGGAGCAGTCAGAGTTGAAGCGTCTAGTGCTTCAGAACATGGAACGTGAAGACTTCTTCGCATCCAGCCCTGGTCTAGAAGAGACTTC
AATCGACACTCCACCATCCTTGGCCGCCTGGCCTCCATTGATGCCCCGACCAGCCCAAGGACCAAATCGTTCTACcAATCAGCACAACCAACAACAGCAC
CGAGAAGCTCGAGAGCCCCCAAGGGCTGGATATGGAGTTAACGAAGAGTGGAACAACGCAGAGTTCGGTCTTCGCCGTGGCCGCGGATACCGTGGCAACA
AGTGAAGAAGATACAGCAGAACTTTCAAGAACACTACGAGTGTGAACCATAGAGAGAGCGAGAAAAATGAGTGAGCTCGTGTGAGGTTCCCGGATCGAGA
TTAAGAGGTCAAGAGGCGGATCCTGGTGCGAACGAACCGAATGGAAACGGACCCAGGTCTCGCGTGGTGACGTCGTGCGATCACAGCTGTCCTATAGAGA
CCCGTGCACTgACGCATCTCAAGtAGCTCGACTCCTAGCAGCATCCCCGTGACGCCAACCGGAGAAGCCCAGCACGCAAATCcaCCTCGTTCCCTTCCCA
TGTCACATGGTGTCGTCTGTGAaGTCACTAATCCCTCCTCGTTTGTTCTTGTTctGGGGCCCaTtCCTTCTCTCATGTCACTAAAGTGcGGGGCCTCTGT
ACctCCATCTGCCTGATGTCTAATGGCTCTGTAGCCAGCCCCATGGACTCGCCATCGCTGCGCCGCCCTGCGGCCTCTCcGCCGCCCTTCGACCGTGACG
ATGGCATGGTCTtCCTGCCACATGCCTCGCCCTTCGTCGaggcTtCTGCGTCTGtCTCtACGTCGCGCTGGCCATGGTCGCGGCCACGCGCGCGCTCTCC
GTcGCCCCGCCcGTGTCGGcGGCCATGCGTCGCCAGCCCGACGCCATCAAGCGCCAACAGACCTtCCAGCGCCTCATGATCGTCTTCGCCGTCGTGCGTG
ctGTGTGCTTtGTGACgACGGGGCTGCTGCGTGGCCTGCTCAACCGCCTCGCGCTGTGTCTCTTCTTCTCGCTCGTGCTTTTCCAAGTGCTCTTCTGGAT
CGACATCGCCAACCCCAAGCTCTCGACGCGCTCTCGACGCATCTGGAACGCCTTCATCCTCTCCAATGCGCTCTTCTACACTGTCGTGTTGGGGCTCGTT
GTATTACGAGAGCGCGAGTtCGCCGGCGAAGGtGCGGCGGCATGGACGGCGGAGGAaCACTTGGAGCACGCGCGCGgTTGGGACATCTTGCCCGtGTTGC
TCATCGCCCTAGGCAGCcTtGCAGCGTCGCTGGGCCTCCTGTACTCGACGTGCAAGACACGTCGTCGTGTCGGACGCGTGCTTCGCCAGTTCGCGgAGCA
GAGTCTGCCCAAGCGCTTGAACGACCGAGTcgAAGCCAAGCTCCAGCGTGCACTTCGCGTCACCAACCTCATCATGGGCGTTTGCTCCGTCGTCTTCCTC
ATGCGCACGCTTCTTTATCTGCAACGCCCGTTCTCGCACTCCGAGTGCGGGGCCATCCGTGATCCGAATGCTTGCATTCTCGTCGGCTATGGCATCCCAG
AGCTCGTGCCTTGTgCGCTTTTCCTCGTGCTCATGTGGGAGGTAGAGCCGCATCTCGAGCTACCGTCCAGACGCAAGTCCAGTGTCAATGTCGCGGCCGT
GGCCCGTGTGGCGGAGACCACGCCACTGCTATTGGACGCTCGTCGACGGAGCTCGGACTTGTCAGTTGATGTCTCGGTTCCTTCACAACGTGGGTCACGT
GTGCAGAGgCCAAGTCCGTTGTCATCTGCTCTTGGTGGTAATGTCATCGCTGCTGCCAGACGTCGCCTTCGTCGTGTGCTGGAAGAGAGTTTCGGAATGC
GCTCTGAGGACGAGAACTCGGGTaTCTCCGGTAGTGGACCGAGTGCGGCATCGGGCACACGACCAACGGGAATTGGTGGCACCAAaCGGGAATTGAGTGG
CGTGAGCGTAGATTCGCCTCGACTGTCGAGGTCCAGTAGCGACCGACGAGAGCAGGGTACGT