Description :
From Genome Similarity Track
Location :
Scaffold_134:56150- 57622
Sequence
1472 bases(100 bases per row)
CTGCTCATCAGATGGACCTGGTCATGAAAGCCGGTTTTGCCATTGTTGGGAATGGAGACTTTGTGAAGAATACAAAGGATTTAATTGTTCACCTTCGCCG
CCAAAAAACGCTGATTACTGAAATGGGAGGTGCCGCCAAAAAACTAACTAATCGGTGGCTGTACATGGGAAACGCATTGCCGTGGATATTAAAAAACCAT
TTTCGCCTCGAAGAACACCTTGATGAAAATGTGTCTGCGGCACCAGCGCCATCATGGTGGGTCATTGCAGCTGTTGTTTGTGGGATAACGGTGGTGATGA
ACGTCACGTTTGTCAAGATACAGGGGAAGGATGTCCTGCTCTCGCAGCAAATGGCAGAGATTGAGCTCCTTGTAGACCGCCTTCGCAAACTGGTACGAGT
TGAACGCGTACCTAGCTCTGAATTCCAATCTAGCGCTAATGACACGATTTCTACGAAGTACTGGCTCAAAGAGCAACACTTGCTCGAGTTTATTCAAGAC
CAGGGGACGTTCGTCAAGAATCACATGAATAGTGTTGCAGATGCCGACAAAAATTCGATTCTGAGGCAGCTTGGCAAGTTTGTACTGCATCTAATTGAAG
GTATGGAGCATGTACAAGCTGAGCGAGACAGCAACAATGACGCTGCCGCATCTCCGGCTCCGCCAGTAATGCCAGCTGAGCTTGTCACAGTCCCTCCCCG
CCAGTTTGCAGAAGATATTTTGAATCCTCGCCGCGATCAATTGGCTTTGTTTTGGAGTGAGGCAAAAATTGAAGCCGTTGAACGGGAGCATCGAGAGCTG
TGTCAAGCCAATCTGCTTGATGAGATGGTTCGCACAGCCCTGGAGGAAGAATCGTATGAGACCAGCTTCAACGACGCCTGGGATTCAGTGCAAAACGCTG
CTGCTCCAAAGACATTTTCACATCTCCGCCAGTTCTGCTGCGGATTGGCAACCGTATTCGCGAATACGGCGTCCGTCGAATCCGATTTTTCCGTATTGAA
GTGTGAACTGAACGACCGGCGCACTTCGTTGACTTCTCTAGCCCTTGAAGGCATCTTCCAGGCTAAACAGTTCGATATGCTAGAGAAATTGTAGTAAATT
GCATACTTTATTTCCTTAAACTGGCACTGTGCCGAAATAAACAAAACAAGAGTGCCGAAATATAGCTAATCCGACACATCCCGGCAGGTGCCAGTACAGA
CAACGACTTACAAAGCCGGCAGACACAAAAAGCCGGCAGACGAAGTCAAGCAAAGCTTAACATAAGCAAACCAGCCAATCAGATTCAATCAAATGACTTC
ATCTTTGTATACCATCTGGTTTTGTGTACTTTATATGCTTTCTTGTGTACTTTATGCAACACGCCGTGTGTTTTATGACAGTTTTACAGATTTGACGGGA
GGGAATTTATCGTTGTTTTTATATAGGAGGATGGCATTAAGCATGCCGGCTTTGTAAGTCGTTGTCTGTATA