Description :
From Genome Similarity Track
Location :
Scaffold_63:5615- 9735
Sequence
4120 bases(100 bases per row)
CGGGAGAACGTCGACTTCTAGTAGGTGCGGGGAGCCCTAACAGGAATAAACTAGGCTCTGTAGAGGCTCTAGGAGGTAGAGATGAACAAGGCTTAGCCTT
AAACGACCTCGTGTAATTGACCACGTAGCGTGAATATAAGTCAGGCTTGTTGGTTGCTTCGGCACTGATCAAGGGCTTTGAGAAGCCGTGGTCAATTTTG
ATCGACGCTGGGGCATCGGGCAACTACGTCCGACTCCGTTCCACTGAAGGGAGTCAGCAGTATGCTGAAGCGATGAAAGCGAAAGAGGGTGATTTTATCA
CAGTCCGTCTAACAACGGGAGCCCGCGTCACCTCCCTAAAGTTCCTTTGAACTTAAGTGTAAATTGTTTTAGACTTTGACGGCATTGAACGCTGTCTTTT
CCTAGATTTGGACTAGAGATATGATCTCATTCTCGGTATGGTCTGGCTGGAACGCCACGAGCCATATTGATTTGAGGTCTAATACCGTAGGTGCAACGCG
AAATGTTTCTAGTGAAGCTTTGGAAATTCATGAACCCACCTTTGCTAGACAACAAAAGTGCTATTGGCGCGAGCCACTGACTGAGTCAGTTAGTGTGCTG
GACATCGGAACGTCCTGGGTTACTTGCCCATGATGTCAATGACGATAGTGAGACGGCACTTTCTCCGTTGAGTGGCAATAGGTTTTAAAATGAGCCACCG
AATGCTGATAGCATTGATGACCCAAGGTCGAGTCACCTAGAGTGTGAGACCTTAAATGTACGTGACTGGAACGTAAACATTAACAGAGTGAGGACGGCTG
CAATAGCACCTCATTGAATGTCGGTAATGACATTGTTGGATAGATGCATAGGAATCAAGATCTAGGCTCCCCTGACCCACGTGCAGTGGCGATTATTTCG
CAGGGTGATGAGTTTGAGTTAAGTAACTCTGCTCCGGATTTCATTAATGATATCGTGTCTTGTATAGAGCAAATTAAGGTTGAAGAATCTAATCACCTCG
TGGGGCCAAATGTTCCGTCCTCGTTGAGGAGTTCAGTCTCTTTGCAGAGACGACATCGACGCCAGATGTCTGCTGCAAGACTTAAATCGTCTGTAATGTC
GCTGAGCGATACTTGCGGTCAGCTATATACATTGGTCGATGGAGTGACAGGTCACGTGGATCGTGAAGTCAGCCTTGCGGCCCCCCCATTGTTAACTGCT
CTGTTAGAGCTAAACAAAATGTCTGTAAATATGTCCAGTCAGGCCCTGAAGGCAGGCTACTTATCCGATATAGTGGTCCTTACACCGGATAAAGAATTGC
ACTAATCGTCCTTTTTGGATGAGACGGTCCTTGAGAGGAAAAAGGAGGCACTTAGTGCACGTAGTGAGTCATCCATTTTGAAGAATTTTTCAAATCCCTA
CTACCTTTGGTTAAGAATTTTCAGGACGTGGTATGTCCTAATATACCGTCTGTATTCCCTCCCGATAGGGGTACGTCATGAATTGACTTGGTTTCTGGAA
CCAGATAATGCGTTACACGACAGTGGCCTTTACCAAAAGAACAATGTGACGTCATTGACGAGTTTTTCAGTGCTAAGAACGCGGCAGGAACGGTGTGTGA
GAGCAAATCTCCTCATTCCACACCGACATTTGGTGTTAAAAGTCCTAATGGTAAGTGGCGTATTGTGCATGCTTATAATAAGATGATGCGGTCACAAGTT
CCGCACAAACACCCATTCCTAATAGAACGTTCTTCAGAACAACATGGTGGGATGTCCAATGTACAATACACTCGACCTTGTCGATGGTTATTATCAACTG
CTCATGCATGCAATTTATATCCCGCTTACAGCGGTTAGTACTCCAAGCGGTAAGCTTTGAGAGTGACAGGTTATTCCCGAACGCTTTCCAATTCCCCGGC
TACGTTTAATCTTCTGGTGACGCAACTGTTCCGTCCTTACCGTGCTTATACACAAACGTACTTTGATGACATATTTGTCCATAGTAGATCGGAAGGGGGT
CGGTCGGACGTGGATAACCACATCGACCATTTAGGAGCTGTGCTCGAGTGCATGCGCACTAATAAGCTCTATGCTAACGCATCAAAATGCATCTTTGGTG
CGGACGAGATACAATTTCTGGGATGTCTAATTGTGAAGCGAGGTCTTCGGGCGGATCCTGCAAAGGTGAAGGCCATAGTGGACTGGCCAGTTCCAAAGAA
CCAAAAGGATCTACGCAAATGACTTGACCTTGCCAATTACTTGCACAAGTATAGCGAGAATTACGCTGATATGGCTCGACCATTATACAATCTCCTTAAA
AATGTTGTGGGGTGGTGCTGGACTAGCACCGAAGAAGAGGCTTTTATGTACATAAAGGAGAGTCTCCTACATGCCTCGATTTTGGCTTTCCCAGATTCTC
ATCGGCCTTTCAGTGTCGTCTGTGAAGCTTCTAATTTTGCCATTGGCTATGCTCTGTTACAACAGATGTTGAGGGACGCGAGCGTGTCATCTCTTTTGAA
TCCCGTCAGCTTAAAGCTGCTGAAAAAAGAACTATCCAGATCACGACAATAAGCTACTTGCGATTCAGTATGCTATAGTCAAATTCAGATTCATCTGCTT
GGCTCTAAGACTTTTGTAGTCTATACCGATCATGCGTCTTTACGCACGACCACACAATCACATCACCTCTCGCAGAGGATGGCCCGTTGGCTTTCATTCT
TTGCAGAATATAACTTGAGGCAAAGTATAAGCCGGGGAGGCAAAATATGTTGGCTGGTGCTTTGTCACGACGGCCTGACTATGAGCTTGCTCATGTTACG
ATTATGTCGTCGTCAATTACTAAATTAATTCGTACGCCTTATGCCAAGGATGAACAATGTGTAGCTTTGCTACGAGCTCTTAGAAGCGTTGCGTTTAAGG
ACTCAGACATTAAATTGTAGGCCCGTCGCGTGAGGGGCTACATCGATATTCTGTTGATAATGGCATCTTGTGCTGCACATATGCTGCGGATACCTAGCGC
GTCTATGTAATTTATGATGAAGGACTGAAGTATCGTATTCTATGAGGTCCACGACACAGCGATTAGCGGTCATCTCGGTCGTGAAAAGACCTACGGCTTA
ATTAGCCAAAGTTATTGGTGGCTCAAACTCTATAAATGGGTTAGCTCTTATGTGCGCACACGTGAAACCTACCAACGAGTCAAATCCTTGGCTCTTGGAA
CTACGCCGCTGGCTAGCTTGCCTCTATCTTCTGGGTATTGGGAGTCCATCAGCACGGGTTTCGTGTTTGTCCTACCGAATGATTCGAACAGTAACACAGG
TTCCGTGGTATTTGTCGACCGTTTGAGCAAAATAGCTCACTTAGCGGCTGTGCCGGACTCCATTGATGGTAAAGGTAAATTTTTGCAGTTCATTGATTGC
ATGTTTTGACCACACGATCTGCCACTGGCAATTGCCTCGATCAGAGATCCTCGTTTCACGGGTAAATTTCAAAAGTCCATCTTCACAGTGCTCGGCTCAG
GTTAGACATATCTACAATGGATCATCAGCAGACCTATGGTCAGACTGAGCGCGATATTCGCGTCCTCGAAGATTTCCAACGCAGCGTGTAAGCTGATACT
CCTCGGCGTTGGAGCTTACTGCTACCCATCGTTGAGTTTGCCATGAAAAATGCTGTTCATGCCTCGACGGGCTACATTCCGTTCTACGTGAACGGCCTCA
CCCCCCCCGCGTTCCGTTAACACTATTACTACGTGTTTTAGGGCTTGGCTGGGAAAAGATAGTCAATCGGCTTGCTGATGTCAGCCGTTTAATTGTTTAA
AAACAGGTTAGCGCGTTCCTCACAACGCGATTGTATGTCTTAAGACATGGGCGTGACACAATGGCTGATAACCAAGACAAACAGAAGGAGCAAGCGGATG
CTAAAGGCAGAAGCTGTATTGAAAGTTATGTGGTCGGTGACCAAGTATTAATAAACGCTAAATATTTACATACGAATGTAGTGTCTGATGTGTTTAAGAC
GAAGCTGCGTCCTCGGTTCACAGTACCATTAACGGTCGTGGCCAACAAGGGTCTTGTGTATACGCTCAACTTATGCGAAAATTGCGTACACCTCCCGTGT
TTTACGTTGGTCTCCTTAAG