Description :
From Genome Similarity Track
Location :
Scaffold_708:5615- 8614
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_708-snap-gene-0.13Isoform 2 of F-box/LRR-repeat protein 20
Pytap_DAOMBR444maker-pag1_scaffold_708-fgenesh-gene-0.2Ferric reductase like transmembrane component

Sequence
2999 bases(100 bases per row)
ATGGACGAGTCATtCCAGTGTCACTAGATATTCTACGCACGTGTATGCCTGAATATGACGCAGCTTCGGgTGGTGCGCAAGCATCTGCaCGAGAGAGTCA
TCAAACGaGATGgTGGGCACGACAAGaCGCTCGAcAGCTctGTTGGcGCGCTGCAGCAGCGCCTTGACGACGTTCTTTGTCACTTTATCGTTGGCgaTTC
TTGAGAAATCGAGCTCATCAATGGGTACATGGTGGCGACTCAGATCAAGCCAACGCCTGCATACTGTCTCGAGACGTGCGCGGTCAGGCACATACGGGAG
GAATGACAGCACGAGTCGCTCGCCGACGTCGCTCAACGGCACCGTCGACGCCAACACCcGAGAGCTAGTACTCCTCTTCACTGCGCGTTCATTAGACTCG
CAGTCGGCGCCCCTGCGGCGTTGTGTAGCTGCCTTGTTGCTCCTCTTCGTGCTCCGTGTCTTCATTTTGGATTGTGGCGAGGAATAGATCTGCGTTCACG
ACGCGACGGTGGCACTGATAGTACCCCATCAGCCACCTAACAACCCGGGACACTAGCTCAGCATGTACACGGCTCCTTCAAACTCTCCCTCTGCGTCTCC
AAGCGCCCACGACgaGCTCTGCGCTGTCTTCTTCGATCTTACTTGGTCCCTTCCATGTGTTGACCTTGGAgCTGCTCGCCAGACGCGCCGAGAATGGGTA
CATCCAGTCCGTGGCGTAGGTGGTgTCTGTCCGTCGGTGTCAGGGAACGGATCGGTGTCTATAGCTCCCCCACCccTTTTCCGATGCTGGTTCCTTGAGT
GCAGTCCGTCCACCGCCCATTGTTGTGGTCCATCTGGCTCTGGGGATTTTGGTGCGGACACTGACTCGAGAATCCACTGCaGGCGATtCGCATGCGTGGC
AGCGGCTGgACTCCTGTCTCACTCACACCACGCGCGCCGAAATGACTTCGATGATCACAGGCCACACTGTCGTGGCGATCTCAATCCCTCACGACTACTG
GTATCAATGTATCGAGGAGCACAGGCGACTGCATCCTTCGCGACGATTTTCCTGATCGATCCCCCGCTGGCCGTGTCTACCGATGCGGACAAGACGAGGG
CGAGGGGACACGTCCACCGCCTCTTATAGATGCATCTCACCGTGTAGATCGACTGCTGCAACAAATTCATTTACAGAGAACTCaataGCACAGATCGTTG
ATTCCACACATATCGTTGTAGGAAGGATATCATTTTGTAGAACCGTCTCTGGTTCCATCGTTtGATTGCAGGTTGCGGCATCCAGCCATGTGGGgAGTCG
GAGAGGAAACCTGGATGCCAGCTGGCCGCCGCCACTCCCACGATGCCCCATGGCTGATGGGAGTTCCAGTCGCGGAAGAAGCCTGGCGCACGACGAGGCC
GCTCACTCATAAACCCAGTGGaGCGtGCCTGGCGACTCATCCTGGATAACGCCGACGCGCCGACTCGGAGACTGTAGCGACGGTCCGCCACTCTGCACTT
TGACACGCGCCACGCCATGCACCCGTCACAGCGCAGCAACGGCGTGGAATCACCCGGACCcGACGGCAAGTCGCCGACCCAGGGCCGCTTCTTCACGCTG
AGTGgcGATGAGAAGCCCTCGGCTGTGGCCACGCCCTTtGtCTATGGCACACCCATCAAGAAGAACTACAAGACATGGCCCTTTGtGATCGTCGGCCTCT
GCGCTCTCATCGTGCTCTTCGCCTACATCTaCAAGgAaCTCCcTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGgTCAT
CGCGAAGTCGTGgAGTTTTtCTATCTGTTCCTcTACgTCGGTCTGCCGACCATGATTGGTGGTATTGTGCTCGCCGTGGgCAATGCGCTGCCACCTGTGC
CGTCCGGCATCcACCGTACGATCTTCCGCTTCCTCAAGCGCAAGATCCTCGTAGGCCGCGTCAACCTGTCGTACGCTGAGAGCGTGATCACGCTTCTGTT
CCTCGGCCTCAATGcGATCTGGTTCTCGGCCATTTTCGGtCGCAAGTaCAGCGAGGTTGAGGAATCTGGCGCCGTTGACGGCGACACCACGTTtcGAATG
GTCGGCTACACGTTCGGTTTCAACGCAGTGCTcTGCTTCTCGTTGCTCATCCTGCCAGCGACACGAAACTGCTTCTGGATGCTCTCCATGGGTATTGACT
ACTCTCACGCCATCAAGTaCCACCGGTGgATCGGCTTCCTCACGGTCTTCCTCGTGTTTGCTCACTCGATCCCGTACTACCGTGGCTGGTTCCAGGCAGG
CACGTACGTGCAGAGTTCGCTCCCGTGTTTCACCTGTGACTATGGTGAGACTGCCAACCGCAAACGTCTGCAGAATTTTTtCGGCCAGGTCGCTCTGCTT
TGCTGTCTCGCCATGGGTATCACGTCGCTCAACCCCATCCGTCGTCGCTACTACGAGGTCTTTTACTACACGCACCACCTCTTCATCGTCATTCTCTTCG
CGTCCGCCCTCCACTTCTCATCGTTCGTaTTTTGGATGTATCCTGCCGTGTGCTTGTATATGATGCACCGCATCCTGGCGCGTCACCAAGGTGGTGTGCC
GTGTGAGGTCGTGGACATGGAAGCCATTCCTGGTCAGATCACTCGACTTGTCTTCCGCCGCAGCCCTGGCAAGTCTGGTCACTATCACGCCGGTCAGTTC
GTGTACCTCCATGTTCCGCTGCTCTCGAAGACTCAATGGCACCCGTTCAGCATCAGCTCgTCGCCAATTGAaTACGAAGACACGTTCACAGTGCACGTCA
AGGCCATCGGAAACTGGACGAAGGAACTGTTCGctGTTGCTATTCAGGCTCGTGAAGAACGCAAGGTGCCTTTGATCTACGTTGACGGCTACTACGGCAA
GATGTCGGACGACTTCCAACATTACCCTGTTCTCGTGTTTGTCGCCGGTGGTATTGGTGCCACGCCGATCATCAGCATTGTCGGAAAGGTTCTCGACTG