Description :
From Genome Similarity Track
Location :
Scaffold_955:5614- 10187
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_955-snap-gene-0.10Lipase domain protein
Pytir_DAOMBR486maker-pir_contig_955-snap-gene-0.7Ubiquitin family protein
Pytir_DAOMBR486maker-pir_contig_955-fgenesh-gene-0.36-pyruvoyl tetrahydropterin synthase

Sequence
4573 bases(100 bases per row)
GAGCCCTGCGCGTTGAACACGGCGATGAACCAACAAGGGAGAGCGAAGATTGACGACAGGAGGAATACGGCGCGGATGATCAGCTCGCTCACGTGGATCG
CGGGCTTTCTATACATCACCATAGGATTAAAGAACATGGTTACAAGAATGCACCCACCCAGTTGACAAGTAGGAATGCTCAGATGCTGCACTTACGTGTA
CGAAAAGTCGTACGATATTTTCTTTCCAAACGCGTTCGGGTATACGCCTTTGAACACCACGATCACCAAGTAGGAGCCAAATCCGTTGCCGTCCTAGAAT
ACAACAAAGGCATAAAATGAGAAATAAGGATTCATTCCGTGCATAACAGCCACTGTGCTTTAGCAACGTACCCGCCCTTCAAAGTCCTGTGAGATGTCGA
GCAGCGTCGCTTTGTTGCATGCTTTCGACGGACACTCGACCCACACGCTCTGGTTCTTCTCTGCGACGATCTCTTTCTTCGTGTACGGCACGGAATCAAA
GTCGATCCCGTAGAGAGCCACGTCGTACGCGAGCGCGAAGCTCTGGTCTATGATCTCCAGCGACGTGGTGGTAGTGCTGCTATCACCATTCTCGCTCAAA
ATACTCGCACCTGGTCGCCACTTTCGCCACAAAGCATCCATTTTCTGTAGCCCATTCTCTTCTCCGTCTTGAGCATCAGCACCACCCTGGCCATTCAGCG
CGGAGGTCGAGTTGATCACTTCGCTGATGTCGAGAGAAAGCTCGATGGAGCCCGCGTACCGCGACACGTTATTCACGAGACCCGACCAGCGTGCGATGCC
TTTCTTCTTGTCCACGTAAATGCAGGGCTCATGCTGCAGAATGCGGTCTTCGCAGAGCCCACCGGACAACTTAATGACTGTTCCGAGAAACCCCTGGCTC
TGCAGATACGGCATTGCGAACGCGAGGCAAAACGAGAGGTACGTGATCCAGAGCACAGTCGTCGCAGCGCGGGATGAAAGCGTCTCCAGGCGGATACGCG
GGTGCACGACGTTTCGATTCTTCTTGCCATTGCGCTTGCCACCCTCGCCGACAGCCGGTGTTGATGGTGCGAGCAGTAGCGCAGACGAAGGAGACGACGC
ACCTGCTGATGCTGCCTGCCGCTCCTGCATGCGCGTGCGCATCTCGTACGTGTCGCGAAAGAGCTCGGATGACGCGTACCCTTTCGATTGGAAAAGCAGC
GGGCGGTACACTTTGTTCTCCAAGTTTTCTTCATCTTCTCCGCGTTCTTCCTCTGCTGCTGCTGCAACTTGATCTTCTCTATCGCCGTCAACAGCGAATC
TGCCAACACCACCGCCACGCGCAGCGCGAAGTGCACTCAAAGCGCTGCCGCTACCTCGTGTTGCTGCCGTCGCCCCTCCGCTGTCGCCATCCTCGCTGCT
ACTGACGTCGCTGCTGGAGCGTGCATTGCGCCAGGTTGTTGGCAGCATCTTTGGATGTGGAAAGATGCATCTACAGTCGCGCAACATTTTTGGTTTGAAG
GTGTTCTCAGCGTCCTATAACATATTGTTGACAGTCGCATGAGTGCTCGATCACTGTACATGTTTTGTTAGAAACATAAAAAGCAATTGTGAGTTTGCAT
GCAACTGGTGTGATTTCAAGTGCGGCGCTTGCTCCACAGAAGTCGACCCAAGACGACGACGGTGGTCTCTTCAATTCAATGGAGTTTATCAGCTCCAAGT
TTATATTTGTGCAGTGCTTTAATGCTACTGTAGCTTTGTCCCACAAAATACAGCGTGATGGTGGTCACAGTCACAACGGTTGCTTCGTCTCGTCCAACAA
ATTGGTCTCAGTACATTATTCTCCAGAATGACACCAAATACGGTACACTTTCTGTTTTCCATCTGTTTTTGCATGTGCAATTTTGTAAATAGACAAGCAG
TACGTAGTAAACAGCCATATCTTCCATATTTACCACAAGCCCTATAATATTCCTCTTTATTCTTATTTTTCTGACCATTATGGTTCAGTAAAATATGTAC
GCTTTTTGGTTTTTCAATCCGAGTCTGACGTTTTAATGTACGCATGAAGCTCAGCAGGAAAAATGATCATGTGCTTTTTTGAAAGCAGAAAATAATGTTC
TCTATATATTTATTGCTGTACGCAGCGAGGAGTATAGAAACATAAATATTACCCTAAACCCATGTGTATAAATGATATGTACACCATGGCGCTCGAATAA
TTTAATGCAGTGTTGATCTGGCTTACTTTTTGGTTGTTGTGGGGCGGAAGAAGCGCGACTCCATACTAAACGCAAGTGAAACAGCTGATTGCGCCGCGAC
AGCCGCCGCATACAAACCACAAGAGAAACCGCGTCGTCCAGCGCAGCGGAAAGTAGCAGCAGCAGCAACGTAAGACACGCGCGTGCTCGAGGAAGAAGAG
CAGCTCGCCGCGTTCTGATTCACACATTTGTGTGTGTGTGTGTGTGTGTTGTGTGCGCACGCTATCGATCGATCGCCCCAGTCAAGATGATGCATCCAGA
GAGCAGCATGTCGGAGGAGAAACCCCTGGTAATGAATGCAGCTGACTGACTATGTGAACAGGCAAGCGTGTACTAAAGCCACCGTCGCGTGAAACTCACG
CATATACGATTGCCTGCGTATTGTACTGTAGCTATCGGGCGATGTGGGCATCACGATCGCGGACGATGACGGCGACCACCACCAGGAGCAGCAACAGCAG
AGTGACCGGATCGTCGTGAAGGTCAAGACGCTGAGCGAGAAGCCGATCCGCGTCGAAATCCTGCCAAGCGCCACTGTGGGCGAGTTGAAGGAGCAGGTGA
AGAAGCAGGCGAGCGCCGAGGGCAAGTTCCTGCGCCTCATTCACCAGGTACGCTGTATTTCCATGTGAGAGAGGAGGCACCGTGTAATCGTGGCTGACTG
AGCGATTGCTTGCAACTACAGGGAAAGATGCTGTCCGATGACAAGGCGACACTGGAAAGCTGCCGAGTCAAGTCTGAAGACTTCATCCACTGCGCGATCA
GCGCTGCTCCTCCAAAAGCTGTCGTGAGTCAGGTTCGTGTGTGTCTGTGTTGTGTATTATGATGAAGTGCGTTTTCCGCTCTAATTATCTTTTATTTATT
GCGTGTGTAGATGGCGGCGGAAAATCAAGAAACCGAGCAGGAGGACACAAACCGCCGCGGCTTTGACAGACTTCGTGACCGCCTTAGCCGCGAAGAAGTG
CAAGCGCTGCGTCTCTACTTTTACCCGCAACTCTCCTTATATATCACCCAAGCCGAGCGAGTCGCTGGCGAGTCTAGCGAAGATCGGATATATCGACTCG
AAGAAGAGTGGATGGATGCTCAAGGCCCTCAGTCGGAATTCTGTACGTCAACTAGCTTGGTTCTTGCACTTGGCGGTACTTTGCTGTCGTGAATCTAGCG
TGATTAACTTTCCTTTTTCTTTTTTTCTTCTGCAGCGTTGAATGTTGTCCCGACCGCACGGATCGCGATCGACCATCAAATTGACATGACCGGCATGAAC
AACTCGATCCTCGCTGCCGACAACGAAGGCACTGGAACCGAGTTCTTGTGGGGCTTCCTCATGGGACTGCTCTTGGGCGTATTTATGTTGCTGATGGTAC
GTGATTTCTTTGTATTGTGTTCGACTTGTGCATTCTCGAGCTGGACTCGCTATGTGTGCTGACTTGAACTTGGTTTGCTGCAGCTGCTGGACCGATCCGT
TCCTCGTAAGCAGAAAGTGGGCCTCCTGTTGGGCGTGAGCATGAACTTCTTTCTCAGTGTCGTCCCAAAGGCGGTCTCCGACTAGCTGCTTCTGCCACGC
GTGTTCTCTATTTTCTATCCAAGCTCTGCGTGTTCGTACTCGATATTTCCACTCTTTCATATTTTGAATTTCGGGTCTAATATCTTTTCCGCCCAAGAAA
GAAACTCCCGGCACCATCGTCTGACTCACTCTCCGCTCAAGAAAAGCCACCACCCGCAGAATTTCGTCAATCTGCCACTTCTATCAGCCAGCCGTGTCTT
CAACCGAGCCCCAGCGACTGACTCCTCCAGGTGGTGGTGCGCTATGTCAATTTCGCGTTTTCCTCTAGCTTCCCAGAGCACGCACCAGGATTTCTAGAGC
AGTGTAACATCAACATTAAGAGCTGAATAAACGATTGCTGTACATTATGACTGTGACGTGCTAGTTGGTCTTCAACACTCCGCGAGACATTGTTGGTCTT
CAACACCTCTCCATTTCCGATCAGATGTGCAAGTTGCAGTGTGTAAGGTGCTCAATTTTTCATGCTCAATGATTGGTCCGAAATGGGAATAACGATATTT
TCAGCCAATGGGAGAGGCTAAATGGCTTCACTGGCAAGTTCCCGCGTATTCTGTCCTGACTATTATTATATTATTGGCGCGTAGCAGTTTGCGCGATTGC
CAAACCACGACTTCATTTGAATCCCCCCCCAGCTGGCGCCACCGCAGTCAGCCCCGTACGTTCATCACCGTCGTGGCTAGATGATCGGTGACGCAGAGCC
CATCACGCCAGCGCCGTCAACCCTCCTTCTGGACACAGAGGACTTTGAGAACCAGCTCTCGAAGAAGCGTAAG