Description :
From Genome Similarity Track
Location :
Scaffold_222:56126- 58873
Sequence
2747 bases(100 bases per row)
CGGATCCGTTTTATCCGCTGCTAAAGGAGTTTGCGGATGTGGTCTCGGAAGATCCTCCGTCAGTGTTGCCCCTGGATAGCGGTTTACGGCATGAGATTGA
CCTGGAACCGGGTACTAAGTACTGTACTACGCGTCAAAGGCCGCTGCCTAAGGAGCAAGTGGACGCAATAGATGCGTTCTTTGCGGCAAATCATGCTGCG
GGCATGGTTCGAGAATCGAAATCGCCATATACGTCCCCAACGTTCTATGTGCGGAAACCCAATCGGAAATGGCGCATGGTGCATGCTTTTAACAAGCTGA
ATGTGGCTACAGTTCTGGCTTCGACGCCAATTCCCCGCAAAGATGTGTTGCAAAACAGTATGGCGGGGTGCAGCATCTTTAGCGCGCTCGACATGGTCGA
CGGCTATTACCAGCTGCTGATGAGGGAATCGGATATTCCCCTTAAGGCAGTGAGTACTCTCAGTGAGATGTTGTGGGAATGGTTGGTCATACCCCAAAGG
CTTTCCAGCGCGCCAGCCACGTTCAATCGGCTGGTTACCCAACTGTTTCGGCCGATGCGACACTTCGCGCAGACGTATTTTGATGACATCTTGGTCCACA
GCAAGGCTGAAGGGGACAAGACGGATGTTGAGGTGCATATTGAGCACCTTCGGTCAGTGTTGATGTGCATGCGAGAGAATCGTCTCTTTGCGAACATCAA
CAAGTGCCTCTTTGGGGCGGAAGAGATTCCCCTTTTGGGATGTTTCCTTGGGAAGGATGGAATTCGGGCGGATCCAAAGAAGGTACGGGCGATTGCGCAG
TGGCCGACGCCCAAGTCCCAGAAGGATCTGCGCAAGTGGCTGGGACTTGCAAATCATTTGCACAAATACAGCGAGAATTATGCTGAGATGGCCAGGCCAT
TGAAAAACTTGCTGAAGAATGACGTGATATGGTCATGGTCGGGAGAGGCCCAACAGACTTTTGAAGCCATCAAGATGAGCCTACAATCAGCACCAATTTT
GGCGTTACCGGACGAGGGTCGTCCGTTTAGTGTGGTGTGTGATGCGTCTGATTTTGCCATTGGCTGTGCGTTGCTTCAGCTGGATGCCTAGGGCAACGAA
CGTGTGATTTTGTTCCAGTCGCGGCAGCTCAAGGCCACCGAGAAGAATTACCCAGTGCATGATAAGGAACTTTTTGAGATGAAGTATGCACTGGTCAAGT
TTCGGGTTCATCTGCTAGGCAGTAAACCGTTCGTTGTCTACACAGACCATGCCTCGTTGAGGACGGCGACGCAGTCGCCACACTTTTCGCAGCGCATGGG
GCGTTGGTTGTCATTCTTTGCGGAATACAACTTCACGGTGGCTTATAAGCCACGGAAGTAAAATGTGCTAGCTGACGCGTTGTCAAGGCGTCCTGATTAT
GAGCTGGCACGTGTGGTACACCTTGAATCGACACTGTTTGAGCTCATACGCGGGGCGTATTCTCAAGATCCGGACTTTTGAGGTGTTATTGAGGCGCTGG
GCACCTCATCGAACGTCGTCAAGCTGACGAAACGCCAGCAGGCACATCTCCATCGGTATAGCCTGTCCGACGGACTTCTGCTCTACAGTGTGAATCCTGG
GGATGAAAAGCGGGTGGTCGTTCCAAACGACGAAGATTTACGCCACCGGATCCTCTACGAGGCACACGATACGCCTGGCAGTGGTAACTTGGGGCGCGAG
AAAACGTATACGTCTGTGGCACGTGAATTTGGTGGCCCCATATGTACAAATGGGTGTGGTCTTACGTAAAGACTTGTGAGACTTGTCAGCGGGTGAAGCC
CCTACCGTCCTCAGCAGCGCCGTCGCAGAGTTTGCCAGTCCCGGAGGACTGTTGGCGCTCAGTGAGCATGGACTTCATCTTTGATATACCGGCAGATAGG
CATGGCCATACTGGGATTATGGTTTTCGTGTGCCGCCTTAGCAAGATGGTGCGATTAGTGGCGGTTTGCCGAAGTGTTACGGCGCCGCAGGCGGCCCATC
CCTTCATTGATCATGTGTTTCGACATTATGGACTCCCGGAGTCTTTTGTGAGTGATCGGGATCCTCGTTTCGTTTCAGCCTTCTGGCAGCATCTCTTTCG
GCTGATCGGGACTCGACTGGATATGTCGACAGCGAATCATCCGGAGACGGATGGTCAGACCGAACGGGTCAACCGTGTTTTGGAAGATGTGCTTCGCAGT
ATTTGTGTGGATGAGCCACCTCAGTGGAGCGCTCAACTAGCGCAAGTGGAATTCGCGTTGAATAATGCAGTGCACTCTTCTACGGGTTTTCCCCGTTCTA
TGTGAATGGGTTGCGGCATCCGCGTACTCCCCTATCATTGCCGAGGGCTTCTGATTTGGAGGGGGAGAGGCTGTCGCTGATGACCTAAGAGGTCTAAGTG
GTGTTCGACCATCGGTCGAGCGTGATTTTCTTACGTCTATTGAGACTGGTGAAGCCATTCGGCTCCGCGTAAGGGAAGCCATGGCTGCCGCTCAGGACCT
TCAAAAGGAAAACAGTGACCGCCATGGGCGTCGGAACACACAGGTGTTTAAGATTGGCGATTCGGTGTTGCTAAATGCTCGCAATTTACCTATACACGCA
GTGTCGGCTGTAGGGATTACAAAGCTTCGTCCGCGCTTCGTGGGTCCGTTCATGGTCATTGGTCTGCATGGCAATGCTTACACTTTGAACTTTCCATCGG
CTATGGCAACGCATCCAACGTTCTACGTTGGGATACTTAAGGCCTAC