Description :
From Genome Similarity Track
Location :
contig_104:56117- 59157
Transcript NameFunction/comments
g11073.t1hypothetical protein

Sequence
3040 bases(100 bases per row)
GAGTTCAGCGACATCTTTCCGGACAAGGTTCCAGCCGCCCTTCCACCCGATCGTGGCGTTCGGCACGAGATCGACCTCGTGCCAGGCGCGAAGTACTGTG
TGACGCGGCAGTGGCCGCTTCCCCGAGATCAAGTCGAAGCGATCGACGCTTTCTTCGAAGGTCGCCGGCAAGCCGGCCACGTCCGCGAGAGTCTGTCCCC
GCATTCCAGCCCGACGTTCTGCGTGAAGAAAGCCACCGGCGGATGGCGGATCGTCCACGCCTTCAACAAGCTCAACGACGCCACCATCCCGGCGCAGACG
CCGATTCCGAGGAAAGACATGGTGCTCGACACCATGTCCGGCAGCACCAAGTTCAGCGCCATCGACCTGATGGATGGCTTCTACCAGATCTTGATGCGCG
AAGCCGACGTGCCGTTGACTGCCGTCAGCACGCCCAGTGGAATGCTCTGGGAATGGCTCGTGATGCCGCAGGGGCTCAAGAACGCCCCTGCCACCTTCAA
TCGCATGGTGTCAAATCTGCTCCGGCCGTTCCGCGACTTTGCGCCCAGCTACTTCGACGACATCTTCATTCACAGTCGTGCCGCGGGCGGCATGACGGAC
GTCGAGATGCACCTTCAACACCTGAGGCAGGTGTTCGAAGTGATGAGGGAGAACAAGCTGTATGCCAACTTGAAGAAGTGCATCTTCTGCGCTCCCGAGA
TCCCAGTGCTCGGGAGCTACGTCAGCACGGAAGGTGTCCGTGCTGACCCGGAGAAGATCGAAGCCATCTGCGCTTGGCCCGCTCCTCAGGATCAGAAGCA
GCTCCGGCAGTGGCTTGGTCTCGCGACGTACCTCCACCACTACTCGAAGAACTTCGCGGCAATGATCCGCGTGGTCGTGGCGTCCTGAGCACCAGTCGGC
TTTTGACGCGGTGAAGACGAGCTTGTCCACCGCGCCCGTACTCATGCTTCCAGACCACTCGAAGCCCTTCCATGTCGTGTGCGACGCGAGCGACTTCGCG
ATCGGCTGCGCCTTGATGCAGTTCGATGACGAAGGGCGCGAGCGGGTCATCAGTTACCAGTCGCGCCAGCTGAAGCCGGCAGAGCGGAATTATCCGGTCC
ATGATAAGGAGCTGCTGGCCATGCGGTACGCCCTCATCAAGTTCCGCGTATATCTCCTCGGCGAGCAGACCTTCGCGATCTACACCGACCACGCGTCGTT
GAGAACAGCGACGAAGAGCCCTCACTTGTCCCAGCGCATGGCGCGCTGGCTCTCGCTATTCTCCGAGTACAACTTCGTCGTCCACTACAAGCCGGGCAAG
GCCAACATCCTCGCCGACGCGCTCTCGCGTCGGCCAGACTACGTGCAGTCGGTCGACACGCAGTTGGCGACGAGGATGACGACGAGTGCGCTGTGTGTGT
TGCTGAAGAGGTCGCTGCAGTGGAAGTCGCAGCGACTACTCCACTCCGAGACCTGATATCGGCCGCGTACGAGGCGGACGCGGCGTGCTCCGAGATGATC
AAGTACTTGGGAGACCCGTCCGACACGGCGCGGCGCCGATTGTCCGCACGGAGCCGTGCCCGCATTGATCGATACCAACTGGAAGGAGGCCTGCTGACAT
ACAGCGTCGATCGCGCCGATCCGCCGCGCATCGTCGTCCCGCTGGACGATGACCTTCGGGCTCGGCTGATTCACGAGTTCCATGACGCTCCCAGCGGCGG
CCACCTCGGACGCGAGAAGACTTTCGCGTCGCTCTCGCGAGACTTCTATTGGCCGCACATGTACAAGTGGGTGCGGAAGTGGGTACGCTCCTGCGAAGCG
TGCCAACGAGTCAAGCCGTCGCAGTCGAAGCAGGCCCCGCTTCGACCCCTCCCAGTTGCGGCGGATCCGTGGTCTTCCGTGAGTATGGACTTTGTCTTCG
GGCTGCCTCGAGATGCTCAAGGCCGCACTGGGATTCTCGTCTTCGTAGATCGTTTCAGCAAGATGCTTCATCTTGCTCCGGTCGCTGTCACCATCACCGC
GGCGCAGTCCGCGGCGATCTTTCTCGACATCGTCTACAGGCACCATGGACTGCCGACCTCGATCATCTCCGATCGCGATCCCCGCTTCACCGCCGCATTC
TGGACCGAGCTCTTCAAGCTAGTGGGGACGCGGTTGAAGATGTCCACCGCGTCACACCCAGAGACGGACGGCCAGACCGAACGCGCAAACAGGGTCGTCG
AGGACGTGCTGAGAAGCTTCGCCACGTCGTTCGAGTCGTGGAGCTCGTTCCTGCCTATGGTTGAGTTCGCTCTCAACAACGCCGTTCACGCGTCGACCGG
TCTCACGCCATTTTACGTCAACTACGGTCGCCATCCCCGCGTTCCAGCGCTCCTCGGCATGGAGCGCTCGATTCCCCAAGGCGGCGCTGACGACGAGAAC
GACTCGGCGCACCTTTCCAATGCCGACCAAGTGCCCAGCGGCACTGAGGCCGCTGACGGCGCTACCTCCGCCTTGATGAACGGTGTCACGACTCGGCACG
GTGCCCGAGCCTCAACTCGAGGCATGCGTACGCGTGCCGCCACGAGGGCGGCACCATCCGACATCGCATCTTGGACACGTCGGACGCTGATCAACCCACG
TCAGCGTCCTCGTGCAATTGCATATGAAGACACGTCCGGCGCGGCGACCCCGCCCGCGCCGCCTCCAGCAAACTTTGACCCCATTCCGTCCCCACAACCG
CGCGACACAGCGGCTGTCAGCAAGTTCTTGCAGCGACGCCAGAGTGTGGCGCGCTATGTTCGTGACGCGATTGCAGTGGCAGTCGATCGTCAGAAGGAAA
ACGCTGATCGACGCGGCCGCAAGAACATGGAGAAGTTCGCCGTCGGCGACCGCGTCTTGCTATCGACGTCCGGCATTCAACCCATTTTGGTTACCAATTT
GGGCGCGAACAAGCTCGCGCCAAGGTATATTGGACCATTTCAAGTGTTGAAAGTGTTAGGAGATGCCTACACGCTACAGCTACCTACAGCGCTCCGGCTT
CATCCTACTTTCTACGTCGGTCGGCTGCGGCGATACCATC