Description :
From Genome Similarity Track
Location :
Scaffold_450:5611- 7125
Transcript NameFunction/comments
Physo_145074putative polyprotein

Sequence
1514 bases(100 bases per row)
GTCTGCGGCTGGGTGAGTGCCGAGAGGCTGCGCTTGGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACGGACTCC
CTGAGTCGATTGTCTCGGACCGAGACCTCCGCTTCATGGGCAACTTCTGGAGCGCGGTCTTTGCGGTGCTTGGCACCAAGCTGGACATGTCCACGGCGGA
CCATCCGCAGACCGATGGTCAGGCCGAGCGCGTAAATCGCGTCGTCGAGGACGTGCTCCGCAGCATTTGCGCTGAGACGCCGAAGCGCTGGAGCGCCATG
CTGCCACTCGTTGAGTTTGCGTTGAACAACGCCGTGCACGCCTCGACAGGCTACACGCCGTTCTACGTGAACAGCTTGTCTCATCCCCGCGTCCCGCTGA
CGCCGCCACGTGGTGACCTCGGGCTTGGTGGGGGAGGAGAAGCCGACTTAGCTGATCGGCTAGCCGATGTCAGCCCGGCTACTGTTCGTAAACAGGTTGA
CGCTTTCTTGTCGACGCGTCTGAGTGTCTTACGACATGTGCGTGATGCAATGGCTGAGAGCCAAGACAAGCAAAAGGAACATGCAGATGCCAGGAGCAGA
GGCAATGTTGAAAGTTATGAGGTTGGGGACCTGGTGTTGCTTAATGCTAAGAACCTACCTACACATGCAGTGTCTGCCGTCTTCAAGACGAAGTTGCGCC
CGCGCTTCATCGGACCTTTCAAGGTTGTGGCCAAGAAGTGCCTTGCGTACACGCTCAATCTTCCGAAGAAGATGCGGACGCACCCCGTCTTCTACGTGGG
CTTGCTCAAGCCGTACCAGGACCCGATGCAGGTGCAGAAGGAGGCACCGAGAGTGACGAGGTCACAGGCGCGGAGGTCGCGGTCGTCGAGGACGAGACCA
TCCACACGGGCACCGCAGGTACAGGCGGAAGAATCGGCGCCGGAGGTGCCGCGGGCACAGCGAGAGCCGCAGGCCAGGAGTCGCGGCAGTCGGAGCCTGC
ATGCGGGCCAGGAGGTCGAGCTGACCCTGAAGCACAGCCTGCTGACGCTGTAGCTCCCCGAGCTCCCGGCCACGTTGCTCATCGCGATCGCGATAGTATC
GTACCCAGTCCTCCAGGGCCCCAAGGCGGTTCCAGACCGCTCGAGGCACCTCGATCCATCGCGTCCGCTCGGCGAGCTCGTCGAGTTCGGTGGCAGTCCG
GACCAGACGTGCATCGACGTCATGGATATGATCCCGAAGGGGGCCCGCCTGCTGCCGCACCTCCAAGAGCTCACTTTGAGTCGCGAAGGACCCCACAGCG
GCCTCCACCGGCCCTGCTCGATGAGCATGGGAATCTACATTACCATGTGAAGCGCCTCCTGGCGAAGCGGCGGTGCCGGGGTCAAAACCAGTATCTGGTG
AAATGGCGAGGGTACCCTCACTCCGAGAACTCATGGGAGTTTGAGGTGCCCCTCCGCCAAGACTGCCCAGACGTCGTGGACACTTTTGATCAGCTTCATC
ACCAGCGCCCTGAG