Description :
From Genome Similarity Track
Location :
Scaffold_477:5610- 9462
Sequence
3852 bases(100 bases per row)
GTTTATAAGTAGTGAAATTCTAATTCCCGCCAAATAGTTGAATATGTTATGAAATAAGGTAGACTCACTGTGAGACGTGTGCGAGTATTGGAATTTTTCG
ATCCGCGCGATAGAGAGCTAGTGAGTGTGTTAGAAATCGACACCTCGAAAATCGAGTACCTAGAAGGGGACTAGAGGCTCACCCAAAATATCTTCAGTAT
TTGGTTAATCTACCCTTGCCACCGACAGTGAAAGCTATGCAGTCGCTTTTGGAAATATGACCTTTTACAGTATATTGATTGAAAACTATGCCTTGTACAC
ATAGATCCTCCATGAATTGGTAATTGTGGATTTCCACGCACGGCGGTGCAAGTTTAAGACTAACGACAGTGCGATGGTCAAGGAGGAAGACGAATAGAAA
TGGCCCCGACTTTAAGTGTCTTTAGCCATTCTCAAAAATAAGATTACTGCAGCGCCATTTAATACCATTTCGACCCGTCCAAAGAAGCAGTTCTTACCAT
TTATGCGAGCGAATGGGCTATCACGACGTCATAAGTACAAAACTACGAAGGCCTGCTTTGCCAGCAGCCGTTACAAGCTGAACCCACAAGATGAATGAAT
TAAAGTGCAGTACTGTACTTTAGAGAAAGACTTGTTGGAATTATTTCGAATATTCAAAAATTGTATTGCGATGTTCGTCACCCGAACCCTCAAGTTTCTG
ACGAGTCACTCAAATTGTTATGGATAGTCAGACCTTCCGGGTTGCAGGGATGCATGGGAAACTGGGACTTCCACTTTCATCTTAGTGAACTCGGGAGATA
GGGAAGTTTAAGGTTGGTTAAGACCAGGTGATGACCTGAATACCGGGTATGTCCCTATTTTACTCTGGGCTGGGAAGGCTGTGTCCTCATTGACTCCTAC
CCTTGCAGGATTTTGGCTCTTCCTTAAGCCAAGCTATTGGAATTTCACCTCTAGAATCTTGTCTCCAAACTTCGCTTTTTGCCGTCGTCTTTGTACTTTT
ATCTCTGACTCTGTGTTCGGTCTTTTGACGTTGGCCTTTTTGTAGCGGAGACAACCTTACTCCTTTGTTAGAGAAATACTTATACACTCGTAGAGTCTCT
TAGTGTATCAAACTAAACAGGTATTAACTTAAAGGGTCTCAAGTCTTTACAAACTTAGTGAGACTTAACTCTAAGTGTATGCACAAGCTCGCAAGCTTCT
AGTCCTAATTCAGGGACTAATGACTCCAAGGAATCACGTGGCACTAATTCCAAAGAGTACTAGCCTTAATACAGGCTCCTAACTCTTTCAACCAAAGACG
TCTTAGCAGGACACGTTTCTGAAACTGATCAAAGGGGGAACTGAATGTATTTACTGATATATAGCGATAATAAATATCACTTACGTATTTAGCCATGAAA
CTCTTCTACCCAATCTAGGAGTCCTAATATTGGTTCTTCTGGTGTGACCACACCAGAATTACGACGTACTTTGAAGACCCTATTACGATAGATTCCAGCT
ATATGTAATCGATAAGGTACGGTTTTACAGCTAGTGTATGTGATGCAATAATACGCCTATCATCTTTACTGATCTCTTTATGTGTGTATCACACCAGCGT
ACCTGGTTACCACAACTATTTGTGTAGCCCCCTTAAACCTCCCCCACTAAACATTCGATACCCCGAATTAACATCCCTCACCTTTCTCATTGAGATAGCT
GGGAGAGAAATTTTAGTATCACGGTTGTGTAAATGACACCTTGCGCATCAATGGCAAAGTCCTTGCATTCCTCCGAGTCTTTGGAAGGCATCGTGCAAGA
AGAGAACATCGTCGATCATGATAGCGACAATGTCGCACCAGGGGGTTAAGAACTCGAGCCTATAGGTCAGTGTCGAGAAAACCCTCGCGCATAGCGCCGA
ATCCATTTCCTAAACGAAGTACAGCTCCAGCGCTAACAGTGCTGCGTTCTTCAACTACTCCTGATGAACCATCATCACTAACAAGCTCGATGAGCAACAA
CAGCAGTGCATCGATGAAAACGAGAGAGCTACTATATGTCAGATATTAGCTATTACCGAGGCACATTCGGAATATTGCTGCAAGGCTTTGTGAGTTAATG
AGTTGTTGCGAAAGTTGGTGGGGCAGGTTCTGACCACTTGGTCCACAGGGCAGAGTCGATGACCCTTCACGAGCGCGCTGCACTTAATCGAGGATCTTCC
AAAATTGGCTCATTCGCGGGAGCAGATGAACCGCTTCGGCTCGATCGACTCGGTAGACAAACGACAACGGAAGGTGGAGTAAAACCTGCCTCAGCTGGAC
AGCCAAGTGGAGCATTTGACAAAAGCGCAATTATCGAGGAGGACGTCCCTCCTTCAGGTGCAAGCGCTTTCCAGTCCACGAGATAAGGACCATGATATGG
CTTGGGTAAGCCCACTTAAAACGCTGAATGTGTGCGCAGCTTGCGTGGAAGGTTAAGAGTATAGGCAAGGTCTTTCTTCGCTATGACCGTATACGGCCCG
ATGAAGCGCTGGCGCAACTTTGTCTTGATGACGGCAGACACAACATTTGTAGGTTATTTTTTAGAGTTTAGTAATACTTGTTCTCCAACTATATAATAAT
CAATACATACTCTGCCTTTAGCATCATCTTTTTCTTTTTTTGTCTTGGCTATCAGCCATTACATCACGCACACGTCGTAAGACACTAAAGCGTGTCGCGA
GAAAGTCGTTCACTTGTTTCTGCATCGTGGTAGGGCTGATATCAGCAATCTTTTTTGCAGACTTTCCTCCACAAAGCTTAGAACTACGTAGTGACAACAT
AAGAGGAACGCGTAGGTGTGTGAGGCTGTTCACATGGAATGGAGGGAATCCTGTAGAGGCATGGACAGCGTTAATCAACGCAAATGCAATGTCAGAGAGC
ATCAAACTCCAAGTCCGTGGCGACTCAGCTCAAACACTGTAAAACATATCACCAAAGACTCGATCAATTCGCTCAGTTTGACCATCTGTCTGCGGATAAT
CCTCTGTGGACATGTCCAATCGCGTGCCAAGCACCTTAAAATGAAAGTCCAAAACTTTCCTGTGAATCCAGGGTCACGATTAGAGATGATTGCCATAGTC
AACCCGTTTTGGAGAAAGACACGATCGATAAACAGCATATCTGTACTTTTACAATCTATGGACTCTGGCACAGCCGCTGATCCATTTTTCTTATACGGTC
AACTAATACCACGATTCCCGTATTATCGTCACATTCTTTGGGAAGGCATAACACAAATCCATGCTGATGAACTCCCAACACCCCGTAGGTACAGAAAAAC
TAGCTAGATGCGCAGCCGAATGTGCCGGGGGTTTTACCCTCTGGCACGATTCGCATGTACGCACGTATGTGCTCACCCATTGGTAGAGTTTGGGCCATCA
GTAGTGTTGACTCACAGATCCATGAGTCTTTTCCCGGCCCAAATGCTCACCGAGATCAGTATCATGTGCCTCAAGGAGGAATCGGTACGTTAAGTCTTCA
TCGTGAGGCACAACGACGCGAGGAACATCCGTTACATCCGTGCGATAGGCCAGGAGGCTATGATCGACGGAATATAGATAGACTGGCAAGTAATCGTGTC
GACAATGAGGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN