Description :
From Genome Similarity Track
Location :
Scaffold_1360:5610- 9358
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1360-fgenesh-gene-0.2Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_1360-snap-gene-0.5Chaperone activator Sti1

Sequence
3748 bases(100 bases per row)
GAGATACACACAGCCGCCTGTGCCACGCTGCACTTGGCGCTTGCAGAAGCGGATCTGCGGTCCTTGGGCGGCGACAGCGCTGTCAGGTCCGCGAACAGGT
TCATTTCCATCGCCTGGTCTCGAGTTTCTTGTTTTCTTCCTAACTTTAAGTCAGAGACGTCAACACACACACAGTAAACGACTGCAGATGAGCGTCGCAG
TCGGCGAGAGGTCAGCAACAGCAGCAAAACGTGCACAAAGCGCAGGACGCACACACAGGAGCAGCAACTGTTGCTTCACGCGCACGCTCTCGTTGGCGCC
ACGTTGCTTTTCACTTTTGTCTCGTTGGCGCCAAATTTGATGCTAGAAGAATGATGGTCGGTCGTATAATTTCAGCGCTGAGAGTACCACAGCCTTTTGT
GATGGGCGGTTTCGTTGTGTGTGTCGGTTACACTTTTCTCCATGTGTCATTACTTTCAAGATTAGAAATTATTAGATCAAGTCGAGAAGACTTCACTTGG
GAAATGTATGACTCCGTTGTGTTATGAGATTATATTAACCAGTGTTTGGTCATGATGCCCTTTCATGACAAGCTGTGACTTGTTGCACCAAGGAATGCAC
CCATTCACGATGCTGCACGCAGTGGCGGAAGTGCTGCACGTGAGCACCAGTGAAGCTCCGCAGTGGGAGGAGATGACGCAGCGTGACGCCGAGCGCTTCG
TCGTCGCCGGTGGCCTGCGGCTCGAGCCAGTCGTCGTGACGCCAGCAGCAGCAGTCGCAGCACGCGTGCAGAGCAAGTTTTGCTTCCAGTACATCCGGCC
GTGGGCGAAAGAGCCGCCTGTGCAAGTGCTGCGTCTGCGCGAGGAGGTGCAACGGAGTTTACAGCCGTTGTCGATGCGCCGCGCGTCCGTGCCTGCGACG
ACAATGTCCCTTGCGTCTCCAATGCAGGACTCGAAGCGACGACGAAGCCTGTTGATGGCGATCCAATCGCCGTTCAAAGCCACATACAGTCCCAGTGCAG
CTACCATTGCTGCTGCTCAACCACTGACCCGGTCGGCGTTTGCAAGCCCACGGTGCAAGGACGAGGTCCTGACACCGTCGCGCTCCGGTGCTTCAGTTCC
ATCGACGCAATGCGCGGCAGCAGCTCAACAACAGCAACAAGCCCAGTCACCACAGCCGTGCATCCTGCGGACGCCCGAGTCAGTGATGACGGGCAAGCGG
AAGCGTGTGGGCGTGACCATCTCACCCTCACAGGCGTTGCGAGCTCTACAAGCGGCGCCCGTGCCCCAGTTGAGTAGCTCTTCGCGCTGGAGCTCTCCAA
AGCCGGAGCTACTTGTACTTCAGCGAGCGGCGGAGCTAGAAGAAGAACAGCAGCCACCGCCACTAAAGACGAGGAGACTCAGCGAAGCAGGCGAAAAGGT
ATCTATGGCGTCCTTCTTGGTCTCCAAGCTGTGCGCCTTCTTCACGAGCACCTATGGCGCACGTAACAGCGTCAGTATCTCAAGCGACGACCCTACGAGT
GGCGAAAGCGGCACTGAGAGCGACAAGAGCGAGCCGCCAAGCGCAAGTGGCGGTTTTGATGACTGCGACCTGTTTGGCGGCAATGCAACACTGCTCGCAG
ACATCCAAGACGTCCTCGAGCCAGTCTGGAGCCTGCTTGAGACCACGTCGAGTCGTCTTCAGCGCGCTGTGTGGGGCAAAGCGCGCGACTTTGCATCGCC
CTTTGAGTACATCACCCCCTTTGAACAGCAGCAACAGCAGAGCAATACCGGGGCAGCCCCAGTGAGCGAGCTCAGCTTTGACGCATTCGAGTTTGGCGAC
GAGGACGACAATGGTGGCGTCTGGGCGAACTCCAGCAGCAGCAGCTCAAGTGGGGGCTTGGGCAACACGCTCGTGGTGCGCACAAGGCGCCAGTGCCGAG
AGATGCGGCAGCTCGGTGCTACCTGGCGGCTCTGGTAGAATCTCAGTCACTATCACGGCTAGCCTTTCTCTCTGTATGAAGCAACAGGCCCTAGACCCTC
ACATCATGACATCACCAAAGATAGACAGAGTCGGAAGCTACTAGACGGTAAATATATATGCATGTGCATGTGCCAGCAGTGTCGCTGAGACCTCGTAGAT
AACGTACTCTTCCCCCATCGACTTGCGATGGACGACTCGGCGTCGCTGTCAGTCGAGGGCGACGAGGAAGAAGCGGCTGCGCTGCTAGCCGAGTTCCGCC
TCCGGCCGTCCGTCGAGATCAAGATCTCGCTCAGTGGCGCATGCGAGAGCCCGTACCATCTGCCAGAGTGCAACTGCGTGGCGTCGCTCAAGAAGGGACG
GTACGCCGAGAGCAGGTGCGAGGCGCACAAGCTCACGTTGCGCCACTCGCGGCTGCACCCCGAGCCTCTGGGGAGTCCAGTGCAGCACCACAGCCTCAGC
AGCGATCTCCAATCGCCTACGAAGCAGTTCCTGGCGGCGCCGAGTCGCAAGCCCCTCACCGCTTTGCTCTCGCCTGCCAGTCAGAGTGAGAAGAAGAGCA
GCAAGTTAGGTGGGCAGCTCAAGCCGAAAGCGATGATGATGGAGTCCAAGAGCATGGGCGCACTGCCGCCCTCGAGAGGCATGGAGACAGAGTTGATAAG
CGGAAAGGGAGGCTTGCTGCCGTCGCTCTCGACCTCCATGCTGCACCTGTCGCCTGGGAAGGCGTTCTCGTCCTCAGCTGGCGGAAGTGGTTCCTGGAGC
CCGAGCTTTAAGACCAGCTCTTCTAGCGTACGTGCTCTCACCTCTAGGCTCTAGATCATGGGCTGGAGACTGACGTTGCTCGTGCCTTGATAAGTCGTTC
TCGCTAGGCTCGATCGTGATGAGCGCGGCGCAGTCGAGCCTACCCGTCAAGGACGCGATGGAGATGCTCGATAAATACAACAAGATCCTGCGACTGCGCG
CCGAGACGCCGCGCAACCTGGCGATTCTGCACACGCGCAGGTCGACGCTGCTCGCGGCGCTGGGCAGGTTCGAGGACGCTCTCAAGGACGCCGAGCAGGC
GATTCAGCTGGACGCAAAGGCCACAGTGGTAAGTAGAGGTCTAGCAGTGTCTTGATCGCCTGGTCTGGTTGCTCACTGTAGCTTTCATGTGTGATGTTTC
CAGGGCTACTTCCGCAAGGGCTTTGCACTCTGCGGGCTCGGACGGTTTGCGGACGCGACGAGCGCGTTCCAGCACGGCCTGGCGTACGACATCAACTGCC
GCGAGCTGCGCTCCGCGCTGCAGGTGGCGCTGCAGTACATTCGCTGCCACAGTAGCAGCAGTCAGCTCAGCTGAAGAGGCGACTGTTTGGACAACTATGT
TGAAATGGTATGCCCATCAAAGGTCAAGTGTAGCCATTTGGATGTAGCCATCTCATAAGGCACAACAATCAAGTACCAAGCAAGTGACCACAAGAGCAGC
ATGGAGAGAGCAGGAGAGCACAAGAGGAATGGGTGACGAAGAGAGACTGATATGGAATAAGGTATGGAGTTTATTTGCAAAAGAACAAGCTGCCTTATAA
TACATGTTAGCAAAATGGTCATCAAGAGTCCTGTATCCCTCCTCCCTGGAAGGATAAAGGGGGCGGCGGCACTTCGTTAACTTACTTGTACATCGAAGGA
AGCTCTTTCTTCCGGATACGAAAGCGAAAGAGGAGAGAGAACGCTCGGGTTCTCTTCAGACTCAGAAGACGCACACACGCACGCACGCATACGCCTCTCG
GGCGTCTACAAAGTCTATGGGGAGATGCGTGGCAATCCGATTACCACG