Description :
From Genome Similarity Track
Location :
Scaffold_1659:561- 2109
Sequence
1548 bases(100 bases per row)
CAGCGTTGAACCTACGCCCATTGCCCTTCTTGGCAAATAGCCGATGATCTCGCTCAGTATTGTTTGGTACTGGGTGTGGGGCACTACACTCGTAAGCGTA
GTGTCCCAAGTTCTGGCAGCGGTTGCACTTCTGCAACTGCTTGTTGTTTGAAGAGCGAGGTCTCTCGCTCTCATCATAACAGAGGTCTATTGGTTCTGGA
CATCCAGTCTCTTGTCATCTCGGTGAACGATAACAGCTCGAGTTACCATGAGCCTGCCTCATGCTAAAGTCCTCCTGTTCTGCAGCTGAGATTGCTTGTT
CAAGCATATCCAACTCTAAGCGGAACAGGTGGTCCCTGGTGGGCCCATCTACGAGCCCTTGCATGAACACAGTAATCAATGTGTGTTCATGGACTGGGTT
AGCAATTACACTACTCGCGAGGAGTCGTATGTGTTGAGCGTAAGCGTGCACATCACGCTTACCCTGCTTGAGTTTCAAGAGCTCTGACCGAGCCGTGAAC
TCAGCTCGTGGCGGCTCAAACGTCTGTTTGAGCCGGGTTTTAAAGGCTTCCAGCAACTCAAAAGCATATAGGTCGCTCATCTCCAGTCCTAAGGCCCAAG
TCTTGGCACGTCCCGCCAAGTGAGTTTGAGCAAATGTGAGTTTCATTTGCTCATCGTAGATACGTCGTACCTTTATGGCACTGTCTAGTTCGACGAGCCA
TAACAACAGGGAGTCTTCTTCGACTCCTCTGTACTTGGAGATATCAACTTTCAAGATTTCGGGACGACGCGTGTGTGTCGTCCCGCCCACAGCCGCATTG
AATTGCTGCTGTCTCAACAGCTCTGTCTGTTGAGCACAGAGTTCTCTCAACTGCTCGGCCTGTAAGATCCTTGCTGGTGAAGCAAGGCTACTTTCTCTCT
TTCGGAGACAAGTTCATTTTGAATGAACCTGGCTATAGCGGCATGTTGTTGGTCTCTGTCAAGAGACTCCAATTGCGGTTTCTCCTACGGTAGAACTCAT
AGGTCCTACCGCACTCCATTCGATGTCACTCAAATGGGTATAGTCTTCACGCGCGGCGTGAAGACTCTCCTCCTCATCCAACATGTTCATGTCAGATGAG
GTGGTTGTGGTCGCTGGAAGGACTACAAAGTGCTACCAGGTGTAACGGGGTACGACCTTACCAGATGACTAGTAAGACCTTGTGTTGACTGAACACAAGG
CTGCGTGTTCCCGACGTCACGCGCACGTGGCGTGAGGAAGCGCAGCGAAGTAAACAGAACCAAAAGCTCTGTCTAGGGAAAAAGTAGAACTGTATTTAAT
ATAGTTAAGATTTCTTTGTAAATCATCTTTGTCTTGATCTAACTATATTAAACTACAATCTCCTATGTGCGTTTCTTGCTCACCACCCATTGCGTGTGTC
CAGCAGCGATTGGTGGTTAATTTGGTTGATGTAGACACTACATCAACCAAAAGTGGAGCACCCCAGAATATTACCCTCGGGGGTAATATTCCGCCAACAT
CACCTCTTCGCGAGTGATGTTAATTGGATATTATCTAAATAGATAATA