Description :
From Genome Similarity Track
Location :
Scaffold_3890:561- 1717
Sequence
1156 bases(100 bases per row)
TCTTGGCCGCAATGATCATGTCGTCCAAATATAGACATACGTACACGAATGCGTTTTTGGAACGCTTGACGTAGACACACTGGTCGGCTTCACAACATTT
GAAACCATTCTGCAGGAACACGCGATGAATAGTCTTGTTCCACGCACTTGCAGCTTGCTTCAAGCCGTAGATGGCCTTTGGCAGCTTGGGCTTCATGCCT
TCAGCATTCTCGAGGCCAAATGGAGCGTTCATATAAACCAAATCCTTCAAACCACTGTTTAGGAACGCTGTGTCGGCATCCAGCTGCTCCATAATGTAGC
CGCACGTAATGCAAACAGCGAGTACAACTCGAATCGAGTTCATATTCGCAACGGGGGAGTATGTCTCAAAGAAGTCTATTTCAAACCTCTGCTTGAACCC
CTGCGCTACCAGGCGTGCCTTGTAACGGATAACCCGGCCGTTCTCGTCACGATTCTTCGTGAACACCCAGCGACATCCAATGGAACGAGTTGTCGTTCCA
CGTGGAACGAGCGTCCATGTTTCCGTTCCGGGAATGCGAATTCAGCTCTGACTGCATAGCTCGACGCCACTTTCCTGCTTCGTCACTGGCAATAGCTTCT
GCGTATGTGTTAGGCGTATCTGGAACGCCACCAATGCTGGCCGCGTACGCCAACACTGCCTCTGCGAGCAAACCATCTTCGTCGATTCTGGCACGCTTAG
GAGATGGCGGTCCATCACTTCCACGTTCCACATCTTCATCGTCACCGTTCCCAAGTAGAAAAAACGGCTCACGAGGGCGCGTAGATCGTTCCGTTTCAGG
ATGGAAGATCATCCATGGAACGATGGAGGCTGCGAATGAAACGTTGCCAAAACCAACCCATTTAACCTGGGTTCCTCCGGCGCGGGTAGCTGCTGTATTT
CTGCGTTCCATTCCGGTTAAAGGTCGTCCATCTCAATGTCTTGAGCAGGTACCTCTTCTTCTTCTATCGGTTCATCCTGAGCCGGCTGACGCTCCACTTC
AGACGTTTCATTTTTCCTCGTCATATGGATGGCCGTTCCTGAAGCTGGCGACTGCGTGTCATAGATAACGCCCACCTTCACGCTCGTCCAGCTTGACCGA
ACGTGTCACCTTGACCTTTCGACGCATTCATGTCGTACACACGATGTCCTTTTAAC