Description :
From Genome Similarity Track
Location :
Scaffold_14:560816- 563044
Transcript NameFunction/comments
Phypa_INRA-310PPTG_08533hypothetical protein

Sequence
2228 bases(100 bases per row)
GTGGTGCGGGCGCGTGGTGTCGGGCGAGGGTGTGCGTCACGACCCCGCCCGCATTGAGGCACTGGTGCGCTTGCCACCTCCGTCGACAGGGAATGAATTG
CAGCAGTTTATATGCGCATTGAATTGGATGCGCAGCTCACTACTAGCATACAACAAGTTAGTGCATCCGCTAGTACTGCTCATGAAAGAAGTCTACAAGA
AAGCGGGTGGTCGGAAAAAACAACTTGTGCGCAAGGTTGCTTTAAGTGATGTTGGCTGGGCCCAGGAACATCAAGAGTGTTTTGAGCGTTGTAAGACGAC
ATTGAGCAAGGCGTTGTAGCTGGCTTACCCGGACACAGACAAGCGCTTGTGCGTCTTCACGGATGCCAGCGACCTGCACTGGGGTGCAGCACTAACTCAA
ATACCGCTTGACCAGCAGCACTGGCCCCTTGGCGAGCAAGAACACCAACCGTTAATGATGCTAAGCGGGACTTTCTCGGGATAAGCTAAGCGTTGGGCTA
TAGTTGAGAAAGAAGCCTATGCGATAGTGGAGACTTGCCGGCGTGCGGACTACCTGTTGCACCGTGCGGATGGTTTCGCTCTTTTCACCGATCATCGAAA
TTTGAGGTACATTTTCGACCCGCATGGAGTGTCCAGTGCAGTACCCAAATACACGACCGACAAACTTCATCGCTGGTCTCTACTCCTGATGGCTTATCAC
TACGACATCTTTGATATTGCAGGAGGTGGGTCGACTTACTATCAAGGTTGGGCTCGACGTTTCTAACTATCTGTGCAATAAGACATCTGTAAATGCCTTT
GTCGCTGCAGGTGGATGCGGAGTTTGCGTGGCCTTCACTTGTGGAGGTTCACCGCGCACAGGAGAGTGCGTCACCGCCTGAAGGAGCCCATAAGTCGGAC
GACAACAGCATCTGGCTAGTGAAGGGCGACAAGATCTGGACCCGGAGAAGATGTCGGAGCTACGGCTCCGCATTTGCGTCGTGGGGCATTTTGGCGTGGC
GGGGCGCCGCGCTTCGGATGTGACTTTCTCTGCGATTTCTGCTAAGTTCTATTGGAAGAACTTGAAGGAGGACGTCGTGTTTTTAGTGAGACGTTGCTTG
CACTGTGCGAGTTCGACTGGGGGTCCACCACTGCCACGCCCACTTGGAGAAGCTGTCCACGCGGACAAGCCCAATGAGGTGATCCATTGGGATTACCTGT
ACATGGGAAAAAGTGACTCAGACTTGCAATATGTGTTGGTTATAAAAGACTACGCATAGAAATTTGTCTGGTTGATGCCTACAGATGCAGCAACGGCTGA
CAACACTTTTGACTTTCTCATGGATTGGTTTGCATGTTTCGGTGCGTGTCGCTTCTGGTTGAGTGACCAAGGTACCCACTTCAAGAACAAGGTAATCGAG
GACATGCAACGCGCAATGGGATCTCATCATCACTTTACGACAGCTCGTTGCCCGTGGGCAAACGGCACAGTGGAGGTTGTAAACCGTGAGATTCTGCGGT
GCTGCCGGGCACTGCTGTCCGAGTGGCGACTACAGCCGACAGACTGGCCTCGCGTAATCAAAATTGTGCAAATGGTCTTGAACCATTCTCCCTGCTCTGC
TATTGATGGAGTGGCCCCTGTGACAGTCATGACGGGGTTAAGGGCCATGAACCCCACGGACAGCATTGCGATGCCCGAGCCGATACAGGTGGCTACACTG
GATGAAATTAAGCGCAGCAGGAGTGAGAACATCGCTAGACTACAAGCGGCGCTAGCAGACATGCATAAACGCACAGCAATGGCGAACAAGAAAAAGGGCA
GCTAGCAAAAACCATCGTGATGGCGAAAAAGCACGGTTATGGCGCAATTTGATGTGGGCGATTTCGTCCTTTACGCTGATGTTTGGCAACACACTCGAGC
GAAGCTCCGCGTAAAGTGGTGCGGGCCCGCTCAAGTCACTCCAGCGACATCGAATTGGATCTTTGAAATTGAAAACCTAGTCACGGGTGAGCGTAGAGAG
GCTCATGCTAGCCGTTTGAAGTTCTACGCAGACAACTCATTAGCAGTCACGGAGGATCTGCTCCGGCACGTCGCTCACAACAGCGAGGGGCTCGTGGTGG
ACACGTTTCTGTCTACACGGTACAACACTAACGAAAAGAGGCACGAGTTACTCGTGCATTGGCGCTGTTTGGACACCGTCGAGGACTCATGGGAACCGGC
AACGGTGCTACTCCAGGACGTCCCGGTC