Description :
From Genome Similarity Track
Location :
contig_80:5607- 6800
Transcript NameFunction/comments
g12666.t1hypothetical protein

Sequence
1193 bases(100 bases per row)
CGCTCAAGGCCTTCTACGAAGTCGAAGGCATCGAGCAGCAAACCACGGTTCCGTACGCGCACCAGACCAACGGCACGGCAGAACGCGCCATCCGGACCAT
CGTCACGATCGGCCGCAGCATGCTGCATCACGCCAAGTTGGACAAGTGTTTCTGGGCTGAGGCGGCCATGACGGCCATCTACGTGAAGAACCGCCTGCCG
TCACCCAAGGTGGAGCACAAGACTCCATTCGAGATCGTGTACAAGTCCAAGCCAAGTGTCAAGCACATGCGTGTGTTCGGATGCCAGACGTACATCCTGA
CGCCGAAGGAAAAGCGGCGCAAGTGGGACCCCAAGGCTCGCGCCGGGTTGTTCCTCGGCTACGAAGAAGTGTCCAAGGCGTATCGACTTTATGACATCGA
GGCGGGGCAGGTGGTTGTCAGTCGCGATGTCAACTTCGATGAGTCGGCCTTTGGACTTTCGGCGCATACTTCGGATGAAGACGTCGATGATGCTGCGCTG
GACCTGGACGCGCTGGACCTGGACGACAACGATGGACCGCGCCAAACGAGCTTCAAGCAGGCGGGGAAGCGCAAGAGCCGACCGAGTGGCGACGACGACA
CTGCCAGAAGATCGCGCCCCGTTCGCCACCGAGCTGGCTTAGAAGAAGCAAGTGCGCCGGACGTATCCTCGTCGCGCCGAGCTGAACCCGACGAAGAAGA
AAAGTCTGGGGACCAAGATGAAGACGACGACTCGACGCCTCCAGTGTTTTGGCGTGCCAGTGCCAACGCTGTGGAAGCAGCAGCCGATCTATCGGAGCCG
ACGACGTTCCAAGAGGCTGTGAACGGTCCGGATCAAGTGCACTGGCGCAAGGCGATCCGCGCGGAGCTCAAGTCGATGCGACTGCGTGGTGTGTTTCGAG
CTGCCAAGTTGCCCAGCGGCCAGCGCGCCATCGGCACCAAGTGGGTGTTCAAGATCAAGCGCAAAGCGGACGGCTCGATCGAGAAGTACAAGGCGCGCCT
CGTGGCCAAGGGCTTCAAGCAGAAGTACGGCATCGACTACACGGAGACGTTCTCGCCCGTGGTCAAGTACGTGACGCTGCGCATGATCATCGCGATCGCC
AAGTACTTCGGCTGGCCCCTCGACCAACTCGACGTCGTGACAGCGTTCCTGTACGGGGTCATGAAGGAGGTGGTGTTCTGCGTGGTTCCCGAA