Description :
From Genome Similarity Track
Location :
Scaffold_126:56061- 57954
Sequence
1893 bases(100 bases per row)
GAATCGGCGAAGAGCAGCGGCGGGCTGTTCGTAGTACACAGATGGGTACGCGGATACGACCACCCCTTTAGCAATCTGATCGATTCTGGGGCGTCGAAGA
ATTTCGCACGCCGCCAGACGGTCTCTCGTAATAGCAACAAGTTGTCGGATGCTTTGAGAGAAAGCAAAGGCAACGGGACGGTGCGACTGGCCGACGGGAA
GGTCGTCACTGTCCCCAATGTCCAAGTGGATCTGGCCGTCAAGTTTGAAGACTGTGACAGTCCAGAATGGTTTACTGTTCTCGACATGGATCCCTACGAT
ATGATCCTGGGCATGCCCTGGCTCGCGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGTCGCCCTGCGAAGGCTGACAGAGCAT
TGGTGAGTCAGGTTCCCACCTCTGTCGGGACCCGGGGCGCCCGTAAGTACTCCCAGTGTACCGAAGCATCCAGCAGATGCTTGGAAGTCGTCGACGCATA
TGACGACTCCGAGGACGCTTCGATGGTGGCGGCGCCCAGAGGAGGCGCTGGCCAAGTGGGTAACTTAGGTCCACAAGCGGGTAACATAGTTCTGCAGACA
GCTTTAGCTGTCACGAACGCTGGTGATAGCGTGTCCAAGGTGGGTAACAGCGCTCCACACACGGTCGCCCAGACCTTAACTGAAGAGGAAGACGTCGGAT
ACGCTTCCTATGTGGGTAAAACAGTGCCACACACGGTCATCCAGACCATAACTGAAGAGGAAGACGCGGGACGCGCTTCCTGTGTGGGTAACATAGTATC
ACACGAGGCCTCGAGTGTCTCGGATGCCGGCACCTCGACATCCCCAGACGTGGGTAACGAAGTTTCACGTCACGGTCGCCGTCGACGATAACGCCGCCGG
ATCTGAACCTCGTTCAGATCGACGTCGCTTCAAGCGACTCGGAGTCCAGGTCCCTGGCTCCTCCGACACGGCCGGTGGAAGAGTGTTATCACATCTTCCG
GTTTACCCGTCAAAGCATCTGGTGTCCATTTGGAACCGTTGGCAGATATTGCAGAGATACTGAACCTCGAGGGAATGACGGTCGAGGCTTTCCTGGCCAA
CCTCAAGGCTGGGAAGGTAGCCGAGATGGTGCTCATATGACCTGAGACCACTCGGGAGGAGCTAAACTCCTCCTCTGCCTTGGACGAGGACGTCCTGGAA
GACCTGAACAAGCAGCGTCAGACGCGCTTGGGCTCCGAGATCCTTAAGAGCCCCAAGGATCCGGTGTATCCTTTGGTGGCGGAGTATGCGGACGTGGTGA
ACAAACACCCACCGACCCAACTCCCACCAGATCGAGGTGTACGGCATGAGATTGATCTCGTGCCTGGCACAAAGTACTGTGTCACGAGACAATGGCCTCT
TCCGCGCGAACAGTGCGAGGTCATCGATGCCTTCTTCGCTGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAGTCCCCGCACTCGACACCAACTTTC
TGCGTTCGGAAGCCGATCGGAAAGTGGCATCTAGTTCATGCTTATAACAAGCTGAACAACGCGACGATGCCGGCCCAGACACCAATCCCACGAAAGGATG
TGCTGTTGAACAACATGGAAGCGTACTGTACAGTGCGCCGGATTTGGTAGACGGATACTACCAGATCCTGATGCGTGAGAGCGATATCTCACTCATCGCG
GTGAGCACTCCAAGCGGCATGCTTTGGGAGTGGATCATCATGACGCAGGACCTGTCTAACACCCCAGCGACATTCAACCGCCTGGTGACGCAACTGTTCA
GGCTATTACGTGTCTTCGTAAAAAACGTACTTTCGACGCACATCATCGTGCCGAGGAAAGCCAGACGCGCCCATGGAGGTGCATTCTAGGACA