Description :
From Genome Similarity Track
Location :
Scaffold_13:560587- 562893
Transcript NameFunction/comments
g18430.t1hypothetical protein

Sequence
2306 bases(100 bases per row)
AACATGCCCGGCGCCGATCACAGCTCACACAGGAGGAGCGTGCCGAGGAACGGATAGTAAACCAGGAGCAACATGCCCAGCGCCGATCACAGCTTACGCA
GGAGCAGCGTGCCGAAGATCGCATGATAAACCAAGAGCAACACGCGGAGCGCCGATCACAGCTTACGCAGGAGCAGCGTGCTGAAGAACGGATGGCAAAC
CAAGAGCAACACGCGGAGCGCAGATCACAGCTTACGCAGGAGGAACGCGCCGAAGCGCGAAGGGTAAACCAAGAGCAACATGCGGAACGCCGCAGAGAAC
AGACTGAGGAAGAAGCACTGGAGCAACGCGAGAGAGAGCGATTTCGGCGTAGATCGGCTCGACGTGGAGAGGCGTTGGCAAACCACGACGATTTTGACGT
GGCCTACGTCCAGGGTCCAGACGTTGTGAATGGGCGCCATCGGCTTCCTCCCACCACTGTTTGTGAACATTGTGGCGCTTGGAAGTGGCCTGGCGAATCA
AAAATGAGCTGCTGTCTGGAAGACAAGGTTCGTCTTCCCCCTTTACGGTCTGCACCTCCAAGATTGTTGCAACTGTACCGGGATCCAGCGTTTCGACAGC
ACATACGAGCGTATAACCAAGCTTTTGCGTTCACGTCCATTGGCGCTTCGTGCTCCAACCGATCCTTCCAGGACGTCAACCAGGATGCAAGCGTAGCGGG
ACAGAGGGGCGTGTACACGTACCGCATCCAGGGTGCAATGGGTCACTACTTGGGATCTCTACTCCCCTATATTGATCCCGCCACCGGAGAGCGCACGGAC
CCTAAGTTCGCGCAGATCTATATTGTGGACCCGGACATGCAGCAGCGCGCCCAACGCCGCAGAGGAATTTTTGCTGACTTGGATCCTGTGGCGTTGATGG
ACATCGAGCAAATGATGGAGCAGCACAACCCATTTGCTCAGCAGTTCCTGAGTTTCGGAGAGCAAGTGCGCTCGCGAGACACGAGCGACGTCATGGATAT
GGTGTCCCGCCTCCATGAGAATACAGTGCATCCTCGGACATACAATTTGTCAACCGTTTCTGAGGTAGGCGCGACGCTCATCGAGGACGGCAACCTGGAT
AGGCCTCGCGATCTACTACTGTATACTCGGGATGACAGGCTTCTGCGACTGTTCGAGACGCGCCCGAAGTACGATCCTCTTCAGTACCCTCTTCTGCTTC
CGTATGGGGAGCTAGGTTGGACCTACACAGACACATACGCGAACGGAGTCAGACATCGCAACAAGAACCAGATGTCCCTTCGCGAACATGTCGCCTTCCG
GTTGCACCAAAGAGTGGGAGATCAGTCTGCTCTTCATCAAGGCGGCCGTCTCTTTCAGCAGTGGTGTGTCGACCAACGCGCTAAATGCGAGCAGGAGCAA
CTTCGCTGGGTGGCCTCACATCAGAAGCAAATTCGCGCCGATCAATACAGAGGGCTTCAGGACGCACTGCTGAACGAAGGAACAATTCAGCTGGAAGCAG
GCGAAGGGCTACTCTCCGAGTTTGACAGAGGCGATGGTACGTTGGTCCACCCTGATCGAGGCCGTGGTGGTGATATTTTCTCAACCAAGTGGGACGCCGC
GTTATTCTGCCCTCATCTCATATGGGCAGTCCTCGAGCGATGTACCAGTCCTACCAAGACTCAATGGCCATTGTTAGAGAATTCGGCAAGCCTGATGTGT
TCATGACAACGACCTGCAGCCCTACATGGGAAGAGATAGTGGAGGCCCTTGGGTCTGATCAACAAAACGCTCAGGACCGCCCCGATATTGTAGCCCGTGT
CTGGCAGCAAAAACTGCAAGCTCAGCTTAAAGACCTGAGCGAAGGAGTGCTGGGCCGTATGGAAGCGCGGATTTACGTGGTCGAGTTTCAAAAGAGAGGG
CTCCCTCACGCGCACATCTTGATCATTTTGGCTGAAGAGGACAAGCCACGTACTCGCCAAATCGTAGATCGTATGGTGTCTGCAAAGCTTCCTGACAGAG
AAAAGTTCCCGCAGCTATTCGAGACAATCATGACATGCATGCTGCATGGACCCTGTGGAGCGGCAAACCCGTCATGCGCTTGCATGAAGGACGGGAAGTG
TACAAAAGGATATCCGAAACCTTTTGCAGAGGCGACAAGGACCAATGTGAACGGCTATCCGGTCTACAGACGGCGTCGACGAGCTGAAGGCGTCCTGGTA
TGGAAGGGCAGGGAGTACGACAACGCCACTATTAACCAGTGGGTTGTTCCGTACAACCCGTACTTATCCCAAAAGTACAATTGCCACATCAACGTCGAGG
TGTGCA