Description :
From Genome Similarity Track
Location :
Scaffold_126:56058- 57164
Sequence
1106 bases(100 bases per row)
CTGGAATCGGCGAAGAGCAGCGGCGGGCTGTTCGTAGTACACAGATGGGTACGCGGATACGACCACCCCTTTAGCAATCTGATCGATTCTGGGGCGTCGA
AGAATTTCGCACGCCGCCAGACGGTCTCTCGTAATAGCAACAAGTTGTCGGATGCTTTGAGAGAAAGCAAAGGCAACGGGACGGTGCGACTGGCCGACGG
GAAGGTCGTCACTGTCCCCAATGTCCAAGTGGATCTGGCCGTCAAGTTTGAAGACTGTGACAGTCCAGAATGGTTTACTGTTCTCGACATGGATCCCTAC
GATATGATCCTGGGCATGCCCTGGCTCGCGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGTCGCCCTGCGAAGGCTGACAGAG
CATTGGTGAGTCAGGTTCCCACCTCTGTCGGGACCCGGGGCGCCCGTAAGTACTCCCAGTGTACCGAAGCATCCAGCAGATGCTTGGAAGTCGTCGACGC
ATATGACGACTCCGAGGACGCTTCGATGGTGGCGGCGCCCAGAGGAGGCGCTGGCCAAGTGGGTAACTTAGGTCCACAAGCGGGTAACATAGTTCTGCAG
ACAGCTTTAGCTGTCACGAACGCTGGTGATAGCGTGTCCAAGGTGGGTAACAGCGCTCCACACACGGTCGCCCAGACCTTAACTGAAGAGGAAGACGTCG
GATACGCTTCCTATGTGGGTAAAACAGTGCCACACACGGTCATCCAGACCATAACTGAAGAGGAAGACGCGGGACGCGCTTCCTGTGTGGGTAACATAGT
ATCACACGAGGCCTCGAGTGTCTCGGATGCCGGCACCTCGACATCCCCAGACGTGGGTAACGAAGTTTCACGTCACGGTCGCCGTCGACGATAACGCCGC
CGGATCTGAACCTCGTTCAGATCGACGTCGCTTCAAGCGACTCGGAGTCCAGGTCCCTGGCTCCTCCGACACGGCCGGTGGAAGAGTGTTATCACATCTT
CCGGTTTACCCGTCAAAGCATCTGGTGTCCATTTGGAACCGTTGGCAGATATTGCAGAGATACTGAACCTCGAGGGAATGACGGTCGAGGCTTTCCTGGC
CAACCT