Description :
From Genome Similarity Track
Location :
Scaffold_3:56056- 57464
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_3-snap-gene-0.53DnaJ homolog subfamily B member 3

Sequence
1408 bases(100 bases per row)
CGCGTAGGATAGTCGACGGATCAGACAGCAACTTGAAATCCTTCGTATCCTTCTTGAGAAACATGTACGTCCCACACGGTGCGTATTGATAATCGAGCTC
TTTGATGACATTCATCTCGCGAAATTTGTGGAATGTGTTCTGCAACATCGAGAGGCTCATGGTGATATAAGCTGAGGTGACGCTTCCGATGCCAGCACCA
GCTGCTTTCTCCGCAGCGAGTCCTACAAACACACCTTGCATACTCGATGGCAGCATCTTGAGTAGGGTTTTtgTtgCTTTCGTGATCGTGAGAAAGCGTT
CCGTAGTCTTGGTCAGCATGGCGgCTGATTGGGCgACATTAaGgATTCCTGGTATACAATCAAACTCGTTCACAAGAGTCACAATGCGCTTGGTTAGGTG
AAGGCTGCTAAAAAaaCCGaGCAAAGCGTGGGAGCCAAaGTACGGAGATCCAAAGCCGATTGCCATGACGCGAGGTAACCGTTtCAAGAGTTCATCATCA
ACCAaGTCGAGCCACACATCCGGGgTGTCAATCACGTtGTCGCTGGCACTCAGTCTGGTGCGTTGCATATCCTTCCGTCGAGCTTCGGCATCCTTTTtCt
CAAGaGCCAAACGCGTACGTTGCGGGAGTTGCTGGTACaCAAGCTCACACAGGCCGATCTGTGCGATACTGCCTGCAATTGAGTGACCACACACCACCAG
CATCTTCTGCCGCACTCGCGCGTGACAATACACAGCACCCAAGTCCAGCTGCTGTGCAcGTTTCCAGAACGGCAGGTGGATGCGCGCACCACCGTAACGA
TACACGTACGGTTGGGAAAGCGGCACGGCGGAGCCGAGGACGGCCTCGACAATGTCGGTGGTTTGCGTGGCGCGCACAGCACAAATCACGGCCGTTGCCG
ACTCGACGACGACGTACTTGTTTGTGAACTCGATCACAGGCAAcTGGAGTTTGTGTGGCAaCGGCGATCTGCGGATGAACGCCTCAACCTCACGGCACGC
AGCaTCGCGCTCGGaGGCGCTCGGAGGCTTGGCAGTGTCGGGCACCAGGCTCCGTGTGCTCGCGGCcACTGCAGCACAGAGCAGCGCCGCACTGAGCAGC
TCGGTCTCGCTGGAGACGGCGCCACACCACCAGGCGGCGCTCGAGGCGTCGCgCAGCGTGGCCGAAGTCTCCCTGTTCTCCATATTGCCGACTGGAGAAG
TGATGCCTTGcACATGGGTTCGTGCAGGAGGGAGGGGGCGAGAAGGAGGGATGACGCGCGACGGGGCGCAAAGGCAACTTACACTTTTTGTGACACACAA
AAAACCAGATGGAAAGCATAGTACAGTATAGACTGTGTTTCCTGCAGGCACAGAATGATGGTGACGAtaTCGAATACAAGAGGTCTGTATTAGTACCCCA
GcAAGGGG