Description :
From Genome Similarity Track
Location :
Scaffold_9:560476- 561567
Transcript NameFunction/comments
g5648.t1RAW35753.1 hypothetical protein PC110_g7942 [Phytophthora cactorum

Sequence
1091 bases(100 bases per row)
GCTGCGGTGCTCTCGGCGCTGCTGCTGCACCCTGTCGAGGCCGAGCAAGAGGGATGTCACTGCAAACGAACCATGAAAGGCCGTGAGCACTTGCACCCGA
AGGTGCATTCGCTGCCGGCCTTGTCGCTCGATGAATCGCAGGAGATCGAGCACCTCCCCGCGCATTTGGACTGGTGTGAGCGCGGCTTCTGCGTGCCCAG
TTGGAACCAGCACATTCCGCAGTACTGCGGCTCATGCTTTGCTCACGGTGCCATGTCGAGCGCCCAGGACCGCATCAAGATCCTCAACAAGCGTCGCAAC
TACACTGGGGCCGACGTGATGCTCGGCCGCCAGAGCTTTCTCAATTGTGCGCCAGGCCACGGCCTCTCCGATGGGTGTGACGGAGGAGAAGCTGTCGACG
TGTACGAGTTCATGCGTCAGTATGGACTGCCGGACGAGTCCTGCCTGCCGTACAACGCGACGGACCACACCAAGTACAAGGAAACCAACGGCACTTGCCC
ACCGAGCGGATACTGCATGAAGTACGTGAGCTTTTTGCCTGAATTCTGGGTCATGGGCAGCTCAAGTTACTAATTTGTTGTGCGGTGCAGCTGTATGTAC
ACTCCGCAGAGCAAGGCGGTGCCTCAGTGCTTCCCGGTGACCAAGATGGTGCGTTACCGCGCCAAGAGCCACGGACACCTGTCGGGTGAGCTGGCTATGA
TGAAGGAAATCATGAAAGGCGGCCCCATCACTTGCGGCATCGCGTGCAGTGAAGAGTTCACGTACGAGTACAAGGCTGGTATACTGGAGGACAAGACGGG
CTTCATGGACATTGACCACGACGTGGAGATCGTCGGCTGGGGCGAGGAAGACGGCGTCAAGTACTGGCACATCCGCAACTCGTGGGGCACGTACTGGGGC
ATGAACGGCTTTTTCAAGATCGTCCGCGGCAAGAACAACCTGGGCATCGAAGCTGATTGCGCTTTCATGGAGCCCGACATCAGCGACGAAGAGCTCGTGT
GGGAGGAGAAGTCCGTGTATGGAGGCTCCATCTTCGGCATCGTCCCATTCAAGGAGACCGCGAAGGATCACCCGATCAAGGACACGACCGA