Description :
From Genome Similarity Track
Location :
Scaffold_164:56046- 57759
Sequence
1713 bases(100 bases per row)
AAGCCTGGCGTACAGCAACGCGGGGTCCATTCGAACAGTCGGGGAACCCTTGTTTGGAGGTGCCACCGGCGCGAGCGAGTCTTCCAGGTCGACGAAGCTC
GTGATGCTTGACTGCAGTAGCTGCACGAAGGCGACATCCTTCTCCTTCACGCGCTGCACCTTTAGGTGCCACTGCGATAGCAGCACTGCGAACTGGACCG
CGCGTCTGAAGAGAGACTTCGACTTATGCACCCACTCTAACGTCGAGAATCGTGTATAGACATGTAGCGTCTTTCCTGCCAGCTGGACGTAACAGATCTT
CAACAGCAGAAGTAACGCCAACACTTCCTTCTCAGCAGGATGGTAGTTCATCTCGGCCTCCTTGAGCACCCGACCGAGGAACCGTACGGGGTGTAACTTG
CCTTCATGTTCTTGCATTAGCGTAGTGCTCAACGCCCATTTATTAGCAAAGAGCATGACGTGAACTTCTTTCGACCGATCGAAGTGCCTGAGGATGGGTG
AATGTGAAACACTCGTCTTCATTTTTTTGAAGGAACGACGTGCCACAGAAAGGCCACCTTCAACGACAAAGTCTTCATCCTTGAGCTGGTACAGCGCCGC
ACCGTAGACCGCGAAGTCTTGAATGAAGCGGCTGTAGTAATTAACCGCTCCAAGAAACGACTGCATGCCCTTCTTGCTTGTTGGAAACGAAAGCTCGGTG
ATGGCCGCAAGCTTCTTGGGGTCAGCTCTGATACCTTCTGGCGAAATTTTATGCGACAGAAAGTCCACCTTGGGTTGGCAAAAGATGCTCTTGGTGAAGC
TAATGCTGATCCGACACTGTGCAAATCTTTGTAGCAATCGGTCCAGCGTCGCCAGGCAGCTGTCGAAATCCTCGCCACCGAAGCAAATGTCATCCTCAAA
CGACCGTCGACCAAACACAGGTACCAGCGATGATTCGTCCGGTTCCCCGTTCGTAAACATGTCAGCGACGGGGCTGTTGACGAGTTGTAGTACAGGGTCG
GTCTCTACCGGTGCTTCGCGGTCTGCCGCGAACTTCGTTTGAAACGAACCCTCGGCGCTTGGCCCACGACGTTCCTTGGCTTGTTCTTCAGCTAAACGCA
TCTTCTCCGAGTATTCAAACCAACCTCCTTTAGGTTGAACGAACCCCCAGAGAGCGTTGTCGATCATACGCTGGTAGATCATCGGCGCGTTCTTTAGCCC
GAAGGGCATGCGTAACCACTCGAAATGTCCGAGTGCGCAGACGAACGCCGATACTTTACGCGCTCGCAAGGTCATCATGACCGCCCAGAAGCCGCTTGCT
GCATCCAGCGAGCAGAACCATAGGTAGCGCTCGAGATCTGTTAACAGGTCGTCGACTAGCGGCATTGCATACTCCATGATCGCGGTGATAGCATTCACCA
TCTTGTAATCAATGCAGAGCCGGATGTCCAGCCCGTTCTTTTTCATCACAATCACGATCGGCGATGCCCATGGACTGTCTATAAAGACGATCAGTCCTGC
ACGCAATAAAGCGCGCAGCAGCTCGTACAGTTTGCCGAGAAATCGTAGCGGCACGCGCCGGGCACGCTGTTTAATCGGGGCGTGCCCCTGTGTGTCAATA
TCGCATACCGCGCCGTAGGCTGGCGGCGGCAGTGCGTTACCACTAGCAATCAGGATGTGCTCGTGGTTCTTTAGCGTGGCGACCAGACGTTCTCGGCGTT
CAGTCGACAGCTC