Description :
From Genome Similarity Track
Location :
Scaffold_6:56036- 58976
Transcript NameFunction/comments
Hyaar_Emoy2801218hypothetical protein
Hyaar_Emoy2801219Os06g0222100

Sequence
2940 bases(100 bases per row)
AGTACATTAATGAATGTACGTCGTGGATTTGATCTCGATGTGCCAAAACTATTAAGTGGAGAAAGCTATACGCAGATTACGATGCCATCAGAATGTGTCA
TTAGTTAGCACGCAATTGTGCCCTTGAGACCAAAGAAAAGTGGCAAGTCGACTTTTTTACATTTGACAATCTATTTCACGTACCTCAACTATGTGAACTT
CAATACAATAGTTGAGGGCATTTTGCTGTATTCATCGGGTATCCATTTGAAGTGATGCTGCTGCTGATCAGGCGATACCTTTGCATTTGTAGCGGCAAAT
CCACCATCAAATGTATCTAGGAGAAATTCCCGTTGGCAACGCGACGATTAGCAGCAGTGGGGTCATTGGCACCAAACCGGGTACGCAAGACGTTGTAACG
GCAGATCGCGTCATCGATATTAATGTAAGTGCCCTGGAGATGGCGCACCCCCATCCGAGCATGGGGTGAATTGCTTGCGTCCATGCAGGACTCGGCGCTG
GTTGAAGATGACAGTGTCCCCCCTGTTTTCAGCTTGAATTCGTAGCAATGCTCCCCACCTTCCACTAGATCGTGGAAGACGCGGTAGGCGTCATAATATG
GCATGACACTCTGGAAAGGTACCCGCAGTGGTCCCTCAAATGGTGGACTCCAGTGCACTGCCACAACTTCGTTACGGTGATTGACCTGGATGTGAGGCCG
CTGGTACTCCATAATCGTTGCTTGCTCGCGAGTCAAGTGATGCTTCATGAACGTCGAGGGCACACGGCACAATATCGCAAAGTGTTCCGGATGAAGACGA
CGAAAGTCCTCTGCAACGGCGAAAACGTCCACAAACGTCGACTCACCCCCTTTCACTGATGCGTCAAAGCGCAGTGCGTGCATGAACTGGAACCCAGGGG
GAGACTCGTAGTACGCCAAATCCACGTGGTTCTTCAAATAAACACTCGTGTACGCGATGTTGACCTGGTCGAAAACACGCATAATGTCATTAAACTTGGC
TCGATCCCACCGTCAAGGACCAACTCCCGGCAAAGCAAACCCCTACCGGTGTCGGTTCTGCCACCACGTCAAAGACATCACCATACTGAAACCTGCACGA
CATTGATCGTAAAACCATCGCCCGTTCACACACGATCATGTACATGACAACGCAACGTACGAGTGCGAGATGGGAGAAATGCGTTCGGCGATCGACTTGA
CGACACCCGGCACCGATGGCGTATTACGAATCACCATGAAACCATGTTCAATAACCTGGCGAAGAGCTTCGTACAGACCTTCGTCGTCGTTCGTGTCCAT
CATACGAGCAAAGTCGGTCGAGGGAACAGGAGCATCAAGTGGCAAAGGCGTTGTCGCCATCTCGCGGGCGCGCTGGTCCAGTGCCCAATCCGAGTAGCTG
TTGTCAAGCAACCACTGGGTCGAGAAGCTGGACTTATGCTGGTCGTTCCACACGATATTAAGCGTCTCATCCTGCACTGTACAGCAACAGACCAAAGGTA
CACTAACCATCAAGACGCTCTTCACCGCACAGAGCATGCAAGAACATCAGGAACTTGAAAGTAGCAGTACGACGTACCAAAAACCGTCTCAATGTCCAGT
TCGTCCTGGTTGATCTCGGCACAGCTTACCACTCGCTGCCCCGTCGGGTGGCCGCATTCTGGACACTGACACCACGTCCGTAGATGTAGCAGATGGAAAC
TACTTCGCTTGCCATCACGCCAGCGCAACGTCAAGAAGTCGCGATTGTGTTGTTGCACATGGACCCCCAAGAGCTGCATGTATCTCCTCCACATCAGTCG
ATTACCTCCTAATATTTCAACGACAACCAGCTGGACGAACCTCCTGTGCGACTGAGGGGTCTTTCAAAAGCTCACGAGTGGATGTCAAGCTGGAAAAGTG
TCGCCTTTGTATGGCGCTAGTCTCGTATGGTCCTAGTTCATTGGGATTTAGTCAGCATAACACAGCGCACGAACCACAACTATTGGAAGCTGCACACATT
GGAGCTCACCTTGTTGTATCTTCTTGCATGGTGAGACCGGTTTTATGACCAAAGGGTGTGAGCGGATAGCTGTGAAAGCATGAAGAACTGGTGGGGAGAG
GCGACGCAGTACAGCGCAAGTCATTGGTTTTGTAGTCAGTATCGCGGGTCTAAGGGATATCATCGGTAGATGGCAAGTCTGGAAATTGAGATTTAACGAT
ACTGTCACACGACAGAGGTCGGACCTCGTGGTTTACTTGGAACTTCTTTTGTTATGGTGCACTACACACTATTCATGCAGCCAACACGCTAACTTGCTAA
TTGGTAGCAACGACGAGCTTCTTCATGCATTATGTATGCAAGAGCAAGCGCTAGTAAGTGTGCGCGATGTGGAGTCAAACTGTGCCAGGAGCCCTTTGTC
AACAGCTCAAGTCTTGCAGAGCAAACTATTGCACCGGGGACGGGTCAGCTGGCTGGGGACTGCTGGGTGCACTTTTGTACCCCTCGCCACATGCGATCAA
ACGGTTCAAAAACTCGCACACCTCGTTCGTGTCACGCAGCGTAAACGATGCGTCCGTGGACGTGCTCTCTTCGGTGACAATGATCCCGACGCCCTTGCGA
GCGTCATGTGCGCGAAAGAGCTGGAACGCGTCTTCATCGGTGGTGTCGTCGCCAATGTAGATAGTGTAGACATCATTGTGCCCGTCCAGTCCAAGAGCTT
GGAGGAGCCACAGTAGCGCTTTTCCCTTGTTCCAGTCGAGCTTGGGCTTGAACTCGTAAACCATCTTCCCTTCGTTGAGTCTATACAGCAAAAAGACAGA
CAACGACCCCCAGAGTCAGCACGCATCCACCACAAGCTAACAAGCTACCGATTCTGTCGTACTTGATACGTGGATGCTGGTCCCGCCCAGTGTACGCGAC
ACTCGACATCTGCGGCCACAAGGCTCGATCGACATTTCTG