Description :
From Genome Similarity Track
Location :
Scaffold_10:560273- 562875
Transcript NameFunction/comments
g19206.t1hypothetical protein

Sequence
2602 bases(100 bases per row)
CTGAGGAATGTGAATCTCGAAGTGAGGGATGGAGACTTTTTGGTATTGCACGGCCCGGTAGGATGTGGCAAGTCCTCGCTGTGCTCTGCACTCCTCGGTG
AAATGGTAAAACACAGCGGAACGGTGTTTGTGGGTGGTAGCGTGGCGTACTGTTCACAGCAGCCGTGGATTCAGAATATGACAGTCCGAGAAAACATTTT
GTTTGGACTTCTCTACGATCGCAAGAAGTACGAGAAGGTGCTGGAGGCTTGCGCACTGATGGCGGATCTTCAGACGCTGCCAGCGGGAGACGCTACTGAA
ATTGGCGAGCGCGGTATCAATTTGTCAGGAGGTCAGAAGGCGCGCATTGCTTTGGCGCGTGCTTGTTACAGCGATGCAAGCGTGTATCTTCTTGACTCCC
CTTTATCGGCTGTGGACGCAATTGTGCAGAACGAGATTTTCCAGAAGTGCATGCTGGGACTCCTCAGGAACAAGACTGTCATACTTGTGACGCACAACCC
CGAAATTATTGAGTCACCGCGCATTTCGCGAGCGGTGACTATCGATGATCTGGGAGCCCTGGTGGAAACGCACCATGTGGATAATCCAATCGAAAGTGAA
GCGCTCGTCTCTCCCTTTGCTGCGCATTCTTATGGGTCGGTCACCTTCGAATCTAGCTGTATCGATGGCGAAGGGGAGAACGACCACGGTAACAATGAGA
GTGATGTCCTCCTCGGTAAAGAAGAGTGCACAGACGATGAAAGCGACCGTGGTAACATCGTGGATCTTGCTGAAGAAACAAGTGAGTGTGACAACGAGAT
GGCCCTGATCTCTCCGTGCGCTCCCTGTCCAGGAGCAAAGCCGAGAGTGTTTTCATCAGCTGCCATTGACCATACCACCGAGCTCGAGAAACTTGGAAAA
CTCGTAGATGAGGAGGAACGAGTGGAGGGTCACGTTGGTAGCCACGTCTTCAACGCATATTATCGCGCCGTTGGTGGCTTTCCTATCGTTTTCCTCTTCT
TGATGACTTCTGCATGCTGGCAAGCATTGCAAATTTCAAGTGACTTCTGGCTGGGCGCGTGGTCGAGTGATGGAATCAACAGTGGAGAGTCGACATCTTA
CCGACTTACCATCTACACAGTTCTTGGTCTTGCTTCGGCTTTGATGGTCTTCGCACGGATGTTTATGACCGCTATATACGGCTTACGTGCTGCGCGACGA
ATGTTCGACGCTATGACAAACGCACTCATGCATGCACCGATGCGCTTTTTCGATGCTAATCCGATCGGTCGCATTCTGACACGCTACGGCAGCGACGTGT
CCGTCGTGGACGCGAATATACCACCACTATTCAGCCGAATGTCGTCTACGATTTTTTCCGTTGGATGTAGCGCTGCCACGGCCGCGATTGTAATCCGATG
GAAGGGATTCCTTCTTCTACCGGTGGCGTACCTCTACTATCGCATTGGATCGTTTTACATTCGCCCAGCTCGGGAACTGCAGAGGCTGTCCAAGACAACA
CAAGCACCTGTGTTGAATCACCTATCCGAGGCAGTGGATGGTGGAGCAGTGATTCGTGCTTATGGCCAGGGTCATGTAAATCGCTTCCAAGTCACCAATA
GTGCCAGGCTGGATGACAACAACAAGATTTGGTACGGACAGCTATGCGTTTCCCAATGGTTCTCTCTGCACATCCAACTTGTTGGTAGCCTGCTGGTACT
CGTTGTCACGGCATCACTCGTGCTGCTTCGGCACCAACTCGATGCTGCTGTGATTGGCCTCGCTTTCTCGTACGCGCTGAAGGTATCGCAAAACCTCGAG
AGGTTGGTGCAAGCTCTATCTCAGGTGGAACCTATGATGGTGAGCCCGGAGCGTCTTCAGGAGTACGCGGACATTATCCAGGAAGCCCCGTCGCGACTTC
CATGTGATCCTTTAAAGAAGATGCATCCAGAAGCCTGGCCTTCAGTTGGCGCAGTTGAGTTTGACCACGTGAGCTTCCGATACAAAGATCAAGGCCAGCT
TGTACTGCGTGACCTGAGCTTTTCAGTCCAGGGAGGCGAAAAGCTTGGTATCGTTGGTCGGACTGGTGCTGGCAAGTCCAGTTTGACGATGGCTCTCTTC
CGCATCAATGAGCTCGGGTCTGGATCAATCTTGATCGACGGTGTGGATATTAGTACCATTGGTCTAATGACATTGCGTGAGAACCTCTCCATCATTCCGC
AGAACCCGGTCCTGTTCAAGGGCACCCTGCGCAACTATTTAGATCCGTTCAGCGAGTTCAGCGACGATGAACTATGGAATTGTCTGCGTCAAGTGGGCCT
CGGACCCCGCATTGAAGCTGAGGATGGCAGGCTTGATGGGCTTGTAGAGGAAAATGGTGAAAATTTCAGTGTGGGCGAGCGGCAGATGCTGTGTATGGTG
TGTTCGCTGCTTCGAAAGTCGCGCATTGTGATTTTTGACGAGGCCACCGCCGCGGTTGACCACGCCACAGATCAAGCTTTGCAGCGAGTGATCCGTGAGG
TCTTCAAGGAGTCAACAGTGCTCACGATCGCGCATCGGCTAGATACGATCCTGGACTCTGATCGCATTTTAGTCATGGATGGCGGTAGTGTCAAGGAGCT
TG