Description :
From Genome Similarity Track
Location :
Scaffold_819:560- 8129
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_819-fgenesh-gene-0.0IDS4
Pytap_DAOMBR444maker-pag1_scaffold_819-fgenesh-gene-0.2Isoform 2 of Vesicle-associated membrane protein-associated protein A
Pytap_DAOMBR444maker-pag1_scaffold_819-fgenesh-gene-0.3XTP3-transactivated gene A protein
Pytap_DAOMBR444maker-pag1_scaffold_819-fgenesh-gene-0.1Nucleolin

Sequence
7569 bases(100 bases per row)
AGCGCAGGAGGAGCTGCGCGTCGCATGGGACTCGACATGGATCTCTAGCGACGTGCAGCAGCGACTGCATCCGTCGTGGTCCATAGTGTGGTCGCGCAGA
ACCCAGCATCGATTCTCATCTCAAGAACGAGAAAAGGCCCGACTTATCATGTGCATAAACTCCATCGCTGCGACATCAGATTCACGAGTGGACAACGGCT
CCAAGGCGACGCAGCCATCACCAGCGTCCACGCCAGCGGCGTGGCTCTGGGATGGGCTCTTCTTCATGAAACACGGTGCCAAGCATCACGCCCcGCGGAA
TGAGGACGGCGGCCAAGACCAACACGGTGCTTTTCGGCGGTGGATGTATCTACcGCCCAGTGCAGTGCACCTCGTGCTCGAGTTCGCGCTCTTTCTTTGG
TGACGGCGATGTCGCATTCAGCGTCACTTCGACTGAAGCGCGTGTGCGCCACGCGCTCGACGGCATCCCCCcAcAGAGTCGATGAGCCTCACGCAACATC
AGAGGTTACCTCTGGGCTGCGCAAGTAGAAGTCAGCGTCGCCAAGCGCAACGACGCGATTGTAATCCTGGCGATAGCATACACGTACGAAACTCGCACTG
GCCACGCATGTCGAGCAGACGCGCGCCGCTCGAATCTTGGCGCCGCTGTGCTCTCCACCCACTCCAACGCGCTCACCCACGCTGCGTGGCTCCTCGAACG
GACGGTGCAATCGCACGCGTCCATCTGGCAAGAGCGCTGGATGCGCCGCGCAAGAGACGGAGCCGTGCATCTtCCGGGCGgAaTCTCCGCCTCAAGCGCG
CGCTGTCCACCGACATCCCCCGAcACTATTACTCCCTCCAGCCGCCTCCGTCCTTCCGATGGCTATGTGCCCTGCTCCACGCCCATGCGCCCTGACCTCT
TCACCGCCTGATGGGTCCATGCGAGTCCCGGCCGTCTGAGTTGGTGCATGCGCTCTTGTTTTCCATGGACTGAACCTGTGTACCTCTCAAATCCGATGGT
TGAACATGCAGCCTGGCAGGTTTCGAAGTGCTTCGTGCGACCTTCGCGCGACCTCGCGAATCTCCATTTCTGCCCCcACCACCCATTGGCTGAATTGCCG
CCCCATACATTCTCCCTGCCTGACGCTCTCTTCCTCGCGAACCGACTCCGACTCGGCCAGCACCACCGCCCGCGGTCCACGCACACGGCATCTGCGACGC
CCGCCGGACTCATCTCCACCCGCCTTCCAGCGCCGCGACGTCCCGAGATTCGTTCCATCACAGTGTGGCCAGCGCCCCGTAGTAGTCTCTCAGTCAACCA
CTCGCCACCGCGTTGCGTTTGTTCGGTAGCCCCATGAAGTTTGGCAAGGTGCTGCAGCAGTCGATGCAAGTGTCGTCGACGGCCTGGGAGCGATTCTGGG
TCGATTACAAGCTACTCAAGCGAATCATCAAGGACTGCGCGCAGATCCAGAAGGAAGAGAAACTGCAGGGCAGCACGCTCATCAAGACCAAGATTAAACC
CAACGCCAAAGAAGATAACGAAAGCATCAGCACGTCGCCTGATGAAGTCAACTTCTTCCGTACGCTGCGCTCCGAGATCAAGAAAATTGGCGACTTTTTC
CTCAAAGAACAGGCCGCATACGTGGGTCGCGTCAAGGCGATTGACGAGCAGTATCTGCAGCTCACGGTAAGTGCGAGAGCGCGTGTTGTTAAAGAGGAGC
CGCGTGGGATAGCTGACGAGAGTGTTTAACAGGCGGACCCAAAGCCTGAGGCCAAGACGGAGCTCATGAAGAGCTGCGTGTCGCTTTACAAGGAACTGTT
GCTGCTGGAGAACTTTGCAGTGATGAACTTCTGTGGAATCTCAAAGATTCTGAAGAAGCATGACAAGTGGACGGGCTACGCCACACGCAATAAGTTCATG
CGTACGATCCTTATGAAGCAGCCCTTCGCGACCTATCTCCCGCTGCTCCAGATGATCGACCGACTGGAACATATCTTCATGGAAGCTACAGGCTGTCGTA
TTGACCAGCACGACTCGCGAAGACGAGGAACGGgCGGTTCGAGTGGCTCAGGCGGCAACACATCTACGTCGCCTCAGCCAGGACCACGCTCTCCATCCCA
CACTACTACGACCAATAACACATCCGCTTCGACAGCATCCCCTTCGTCGACCCCAGCAGGGAATACGGCAACCAATCATGCAAGACCGACGGTTAGCGCC
CAAAGTTCTCCTAGCAGCTCCTCATCGGGTAGTCCCACTCGCCGAGGCAGTGAATCGCTTTCGTCGGATGAAGCCGTGTCGTTGGGACGAGTGCATGCGT
TGCGAGACGACGCACGTCACTTCCGGCAAACAGAGGGAGTTGACGATTGCTATGACGGGGATGATGACGGTGACAGTGCAGATGATGCAACGCTACAAGG
CGGAGTCTCTCCACAGACTGAGCAGACGGATGCTCCGATGACCGAAGCTGGCGAAGGTGCCACCTCTGCAGTGCCCGCGCCACTCcGCCAGTCGGTAGAG
CTTGCGTCAGTGTCCGAGGCTCGTCCGACGGGTTTCCGCAAGGAGTACAACTCGGATAGCGATGCTGCGGCAATTGCGATGCTCTCGATGAAAGAGGGTG
CCACTGCTACGGGTGCAGCAGGACTTCGAAGCGGGAGTGACAGTGAAGGCAGCTCACGCTTCAAGCGCAAGGCGTGTTCACCATTGACTCCAGCGATGGC
GTCGAACGGCAAGCGCAAAATGAGCTTCGCCACCATTTTGAACTAAGCCGTGGGTGCCAGCGCACTGCAGAAAGTTGTGATTAGGAAACATTAGTAGTAG
ACAGCAAGGATATTGAAGGCAGGTAGAGCACGCGAAGCACAGATAGAGTATGAAGCAAACGCACACGCAGCCcAGCAACGGGGgagAAGAGCTTCCATTC
ATCGTGTTTtCGtGCTCATCAGCTTTTAAAtGGgAAACGgTTCAGCTATCTATCCAAAAAAaCGTCCTTGGTCTCTCGGTCGTCGTCGCCGGTAGtACGT
GTGCTTGTGGACCAGGCTCAATAAAaGCGGCcGATGAGgAaGAAAaCAATCGCGCAAATGATCATCTGgACCATGGTGAAAGCCTAGAGACAAAGCACAA
TCCAATCATCAACTGTTCATAGACGCCTTGGGATCCGGAACGCGCTGCGTACCGTGGCGTCCTTGGCAATCGCACGGTTCGCTCCAGTATGCGAGTCATC
AGCCCCAGTCGCAGCCGAGCCTGCGATTCTTCGCTGACGAAGAGTCGACTCTTCTCGTCGAATCCGCTGGTTCTCCGACGTCACTTGCTCTAGCATCTCC
TGAGTAAaCATCCACAAGAAAAAAaCGGTTAaGGAAACGAGAACGCGAAGCCAAACAGGCTCCGTCAGGTCAATCGGGATACGTGAGTTGACTTCCATCC
ACTTGGCGAGTGGACGTAAAGCACGTTGCAAAAAGGaTATGCTCTCTTGAGGTCAGCGATGAGTGACTCGCGCTGGGCCGTCATCTGGACGGTGTAGCGG
ACAAGCTATTATACACAGAGGCGTTACTCAACGATCCTAGAGAGCTCTTTCAGAGGCATGTGCTCACCTCCGAGTACTTCTTCTTGAGCTCAACAGGGTC
CTATCAGATACATATCACACGTCGCACGACTAGTCAGTCACATGGAAGTGCTTCCATCAGGATTGTGCAACGTACAACCATTGACGAGTCTCCAGTCGCG
TGCGACTGGTtCTCAAGCAGCGCGTCGGTCAGCTCCGCAGTGTCAACTGGAGCCACATGCGTGGGTGACGACTCTCCAGAAGGAAGAGGCGTCTCCACGG
CCATGCGCTCGGCTAAATGGTCTGCTCGGACTGTTGGCGCACTGCTGCTAATGGTGGAAGTCGACGCCGCCACAGGAGCAGGAGTTGGCGCTGGTGCTGG
CTCAGCCTCTTCGATGAAGCGGCAGCGCAGCTTCTTATTCGCAAGGCTGTTCTTGTCTGCGCGCGCCCACATGTTGGTGAGCTCATCTGCCATCTCCTTC
GACGACTTGGTCTTGACGAGCTCGTAGAAGCTGTCGTCCACGTAGCTGCTCTGCACGAGGAACTTGTCGTTCGAGAGCTGGCGCTCGGATGGGTCGAGAC
GCAGCAGCTCGTCACAGTCCTTCTGCTGAAGGATGACCATGATTGAAGCCGTCATGTTGGGACCGAGCATCCCCTGGTTTGGGCGCACCAGGTAACGCAT
CGGACGCGTCGTCTTCACCTTGAAGGCGATCTTACGAGCCTCCGACGTGTTGCGGATCGTCAGGACCGACTGTGGGGATGTCGTTGGCTGCAAGTGGAAT
GTGAGCGAGTCCGATGGGTCGAGATGCACGACGTTCGTCGGCGCTACTGCGTTGGCGTCACTCATGGTGTCTACTGGGGCCAAGTAGAGTCACAAAGGAC
CGTTAGACAGTGACGAAGTCACAGGACTTCGCTACGGCTGCACGTACCGTGGAGAAGCCGGAGAAGCGGGGATCAGCGTGGGGGTACGAGCTAGTCGGCG
CTGAGCGAAGGCACTCACGAGTGTGATGCGAGGAGCAGAGGGAgAGCGTGAGAGCGCAGCGTCGCGTCGCGTCGCCGCCGTGACCTCGGCGTCGTCGTTT
TCtGCTGCTTCCTCCCAACCGAGAGCGACGAGAGAACAGCACAAGCGCCTAGTTGGCGAATACTTTTCTAGAACAATGTCTAGTTTTGTACTTAATTCAC
TTCAAGAACCCATGTTTACTGTGAGATGTGATGTCATTAGCCACGATATGAGGAGGAGATGACTGAAGAGTTCAGATGATACAGAACGACACACGAGGAT
GACAGCCATGGAAGTGCGCATTTACAGATTGTGACGCGCAGTGATTACAGCTCAGGTCGATTGCGCAGAGGCTATGAACGGGGCTCCATGATGAGCTAAA
CCGAGGCGGCGTCAGCAGGCAGAATACCAGCGTAGAACTTCTGTAGCTGCTGCATTTGGGCCTCGTACTCTTCGTCACTCATTCGCGCCATTACATCGGC
AACAGAGTTGAGCACTGTCATGGCACGCTCATACTTCTGGGACTGCGAAGGTGTGTCGAACTTCGGAGATGGCTGGCGTGTCAAGAGTGCCGTAGTCATC
TGGTTACGACGCATGGTCTTAAGCAGCACATCCGGGTAGGACTCGTAAATCTCCTTGCTGATAGGATGATTATGCGTGACGACCTGAGAGAAATTCACAC
GGGTCAGCATGGAGATCCTGCCTACAGACAACGCATTGGACGTACCTGGTCAGTCACGATGACCATATACTTGCTTGGATTTTCAGACGGACTGATTTTC
ACGTTGATCTTGGCGATACATCCAATGCCACGATACTTCTGACCTGGACGCGTTGTGGCGCCACGGCAACGGGCCTTCATGGCGTGCGTGCACATGTATA
TCCGGTGGTGATGGATGGCCGAGTCAGGGAACTCAATACGGCGGCCCCGCGAGTTCTTGTTGTTCATCATCACCTTCTGCTGGTTGCGTCGGTACGCCTC
CACCGAGCACGATGATCGCATGCGGAACGGCTGGAACGTCTCCTGCATGTACATTTCGAAGTACGCATCGAACTCATACCACGAGTTGAACGACACACGG
CTCATGCGTTTGCTGTCATACAGTTGGATGCGCTGCTCGCGTGGGACTAACTGACCGGCCGCCGATGCCGTCGTGTGCAGAGCCGCATCATTCGCCTCCT
TCATCTTGGCCATCACATCGTCCATAGCCGCGTCGTCATCGTCATTGGAGTATTCATCATCGTTCTCACCACCGGCGTCCCCGGCAACGGCGGCTGCAGC
AgCGGCTGCCGCCACGACAGCAGCATCGGTCGGGTCGTCCAGACCGACACCTGGCGTCTCCTGCACAGCACTAGCAGAGCGCGTCTTGCGTTTCTTCGAC
TCGACATGCTCCAGCGCCGAGGGTACGACGACACTCACGCCGGCGGCCACGGCCTCGGCGATCGCCGCGTTGGCCGCTGCCGCAGCCGCGTGAGCAGCCG
CTGTCGTGGCATCGCTCACCACGTCCACGGCCGCGACCGTGGGCATGATGACGGCCGGCGCCTGTGACACGGGGGCGGTCGAGGTGGGCTGTGCATCGCT
CATGCTGGCGCTTCAACGTCGTGGTTCCCTTGTGTAGACTTGGTGTGGCTGGTTTGGTGTGAGTGTTGTGTGTGGGCTGATGGTGTTGTTGCGCGGGAGG
CGAAGTGCTGGCGATTTCGTGGAAACCACACCATTCAAACGAAAAACCTCACGCCTTTCTTTtGAACCTCACTCGTGgTGGGAACTCTGAGTCGACTCAG
ATGACGGTGTTTGAAGTGGAGGTGACACGAAGGTCGCGCGAGGGCTGCcAaCCAGCGGCAGCCAACCAACGCGCACTGGGgTACACGTCGTTtCGTAACC
CCGCACTGTTGGCTCCGAGGCGGCAGCATTGgTGCACGCATCGAGCATCACTACCACATTGACCATGGCGAAGAAGGTTCCAGCCACCAAGAAGCAGGCC
AAGCCAGCGAGCAGCAGCTCGTCCTCGGACTCGGACTCGAGCAGCGAGGAGGAGGTTAAGAAGGCGCCAGTTGTCGCCAAGAAGGCCGCTGTCAGCAGCT
CCTCGGACTCGTCGGACGATTCGTCGGATGAGGAGGAGACCAAGAAGCCGGTCGCTAAGAAGGCTGCGGCGCCAGTGAAGAAGGCGgAGTCCTCGGAATC
GAGCTCGGACTCGTCGGATGAGGAGGAGGAGAAGAAGAAGCCAGTCGCCAAGAAGGCCGCCGCTACTCCTGCCAAGAAGGCCGAGTCCTCGGACTCAaGC
TCCGATTCCTCGGACGATGAGGAGGAGAAGAAGCCTGTTGctAAGAAGGCTGCcACCccTGCCaGAAaGAGgAGtCTTCGGACAGCTCGTCCTCGGACTC
GTCGGACGATGAGGAAGAGAAGAAGCCTGTTGCCAAGAAGGCTGCGGCTCCGGTGAAgAaGGAGGAGTCTTCGGACAGCTCGTCTTCcGACTCCTCAGAC
TCAGAGGAGGAGAAGCCTGCGTCGAAGAAGCGCAAGGGCTCGGATGCGGACGCCCAGCCTGCCAAGAAGGTCGCCAAGAAGGAGGAGTCGTCGTCTGACA
GCTCCTCGGACGACTCGTCCTCGTCGGAGGATGAGGCTCCTGTGATGTCGAAGAAGCGCAAGAActCGGATGCCGAGAAGCCTGCTGCCAAGTTCCAGAA
GCAGGAGAACGGCAACGCCGCTCCTGTCGCCGACGCTGACACGACCGAGATCTTCATTGCCGGTCTGCCATGGGCCGCCACCGAGGACGAGGTCCGCGAG
AAATTCGCCGAGTGCGGTGAGATCACCAAGGTGAACCTCCCACAGATCAACGGCCGTGCCTCGGGCAaCGCCTTcGTCACCTTCGCCACCAGCGAGGGCT
ACAACGCCGCCCTCCAGCTTGATGGTCAGGACTTCGGTGGTCGCTGGATGAAGATCCGCTCGGCTGCTAAGAAGCAGAACTTCGAGGAGAAGCCTGAGGG
CTGCACCAGCGTGTTCATCGGTAACCTCTCGTGGGACGTCGATGAGGACACGATCCGCCAGACGTTCGC