Description :
From Genome Similarity Track
Location :
Scaffold_163:560- 3592
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G015007Similar to Peg10: Retrotransposon-derived protein PEG10 (Mus musculus)

Sequence
3032 bases(100 bases per row)
TCTCATGACGAATGCCTCTATCAAATGGCAATTCGTCCGGCACCTTGTCTGGGAAAATGTCTTCAAATTCCCTGGCAAGTGCATACACGGGGTTGGTTTT
GAGAGCGTCCCATGACTGCTCCTCGAACCTTTCCTTCCGTGTCTTCTCATCAAGCACTTCAGCTTCCATTGCTGATACTGTGCTGATGTCCTCTGCATCG
CCAACATCGACGATCATGCAGATCTGCGAGATTTCGCCTCTCGCTAGGCTACGCTTCAGCGTCTTCTTGCTCATCGATGGCAAGGAAATCAATTCTTGGA
CAGAACTTGGAGGATTTTCCACTTGTACGTGACGGATTACATTCACGTCACCTTCTTCCTTGCAGACCGCGATATTCACAAATTCGCTCGAAGTGACTCT
TGCTTGGACACTTCCTTCGTCATCTTGACTTGTACCTTGATCAGGGGCACTTGAAACTCTTGATGAAACACTCTTCTTGCTGGTCTTCTTTTTCTTGTCT
TGGGGCGGGTCTCTGCCTATCTTCCCGTCATTCTTCATACTACCATCGCACGCAACTTTGTCGTCGATGGCAAAGGAGACAGTCTTTTTCTGGCGCCTGA
CTGCTCCACCTCCGTTTGTCTTCTTCAAAATGGGTGCCACTTGTGAACATGGGGGGCCATCGCACACCGCAATATCACAAGGGCCATCTGAGATTTCTTC
CACAGATGTATAAACCCATACCACTTCATCCGTTGTCATGCTGCTCAAGTCAGCGCTGCATGACTTGTCAACGGAGATCTTCATGTTCATCCAGTCAATG
CTAGGTTGGTAACGCTTCAACCATGGCATGCCCAGGATGATGTCAAACTTGTCATCGAGGTCGAGAAGGATGAACTCGTCCTCGCCTCGGAAATCTTCAC
ACTTCATTGCCAAGCGAACGACTCGCTTTGGCATCTTCACAGTTGACCCGTTGGCCAACCGAACAATCATCGTCTTCTCTTCATTTGCAACAGGCACAGA
GATGTTGTGCCTGGCAATCACTTCATTTCGAACAAAGTTGTTCGACGCACCAGTGTCAACCAAAGCTCGTAGAGGCGTTGCAATACCGTCTACATGAACT
TTGAGAACGATCAAACTTGACGTTTGACTGACACTCTTCTCACTCGTGGAAACTGCATGTGCATCATGCACATTGGGGCCAGAGTCCTGTGTTTCCACAA
CATTCACAGTCCTCTTCTCGAGCCCAGTAGGAGGCCCCGCCCCTACTGGTCGTTCCCGTTTTTTGACCTTTGGGAACGATCGAACCGACGACCATTATTA
CGGTCGTAGTTGTTCGAGCGCGAGCCCTGTGCCGTTTGCCGATCAGACAAAGACACTTTGCAGTTCCGAGCGAAGTGACCCGGCTTCCCACAACGGAAAC
ACTTTCCATCGTTGCGAGGACGTTCATTTCCAGGCGTGGAAATGTACGAGATGTCCATCGGCTCTGGGCCATCATGAACAACGTTTGGTTGCCTTGGTGG
TCTTGCCGGAAAACCTTGGAATTTGGCTTGCTTGATGCTGAATTCTTCTTGCATCGCACGGCTGATGGCTCCTTCCAGGGTCTTCGGGTACTCACGGAAC
AGCTGGTTCCGAATCGGACCATCGTTCAGACCTGTCATGAACGTCACGACTTGCGTTGGGATGTCAATCGGCTCGTCCACGATGCTCGATACCAAGTAGC
GAGCTCGTTGTGCGTACGAGTGTAGGTCGTATTTACCCTGACGAAGCTTTAAAAACTCTGCGCGAGCCCGAAATTCGCTCTGCGGAGGTTCAAAAGCCTT
CTTCAGCTCTCGCTTGAAGTCGTCCAGGTCGTAGAAGCAATGTGGCTCCGCCAATCGCTTCCCATACGCCCAACTTTTCGCTCGACCCGCAAGTTTTGAC
ATTGCAAACAACACTTGCTGTATTGGGTCCCGTAGTTGTCTTGCAGTGATCGCTGCATCCAACTCAACGAACCATCTCGAAAGAGGCTCGTTTTCTCCGC
CGCGATACGGAGACACGTTCAGCTTCAGAGGCACCGTCTTGAAGGACGAAACAGGGGTTGCGACCTGCTTTCGAGATTCAACAATATCGTGGTGCATGAA
ACTGACCGCAGCGCTCTTTTGGTCTCCAGGAGATGCCGATCGAAGCAGGCTGACCACAGCAGCCTCCCCGATGACATCTCGCATCCGCTCCAGGGCTGAC
CATTCATGAGTAGACAAATGAGAGAAATACTCATTCGGCAACTCGACAGTTTGCGGTACTGCTGGACCGAGTGGCACATCAACTCCTTCCATGTTCCCGG
ACATGGGTAAGAGTAGGTCTTGAACAGGAATGCGCGACGTGCTTAAAGCCGCGTCGTCAAACCTTTCACTCCACTGTGTCGTTGGAAGGACCGCTCGAAG
TGCTACCAGGTGTAAGAGGGCGCTGTTCCAAACAGTCCCTCTAACACGGCACACACGCTTGTGCAATCGAGGAAGCGATCTCCCGACTTGGAGGGAGGAG
GAGGAGCGACTTGAAGACTTGAAGGCAAATTTGCAACTGAATTAAAATGCTGTTATGGTTCCTGTCGCTACATACAATTGAACCTCAAGGGCTCCTAGAG
GTTTTACAACTAAAACCTACACATGCAGAAATAAAACCTATAAATCTGATATATAAAACCTTGGGTACACTGAGGTTGAGCCTAGGGGATCTGCTGGGAA
CTTGAACTTGAAGTACCGCGGAGATTCCCTGCAAAGTGATTGGCGGAAGCCACTCACTTCAGATGGTAGAGACACGTCGGTCTCGTCGCCCAGACAGTTT
CCCAAATAGGAACCATCATTCCGTACATGATTGTGACCAGTGGTGATTACTCCAAAATGCACCAACTGTCTGTGCCGGAATAGTCAGTGACATCATCCAA
TGACGTCACCAGTTCCCATGGGTATCGGCGGTATTACCGGTATCCGACCGGTAATAGTCACCCATGGTGCACTGTGAAGTAGTGTGTGCCACACACATCT
ACCTCCATGTAATGGCCATGAGGGCCCATACA