Description :
From Genome Similarity Track
Location :
Scaffold_1750:56- 2621
Sequence
2565 bases(100 bases per row)
AAGGTTAGTGCTCCGATTGCCAGTCGGCATATGGTCCAATTTTGGTAATCTGAGAATATTCCATTGTTCCACATCTGAGTTGTAGTTTGGGTCATTGCCT
GTTGTTTCCTAGCCGATCTCTTTTGGCGGCCTTGAATTGTCTTCAGCATTGCTGCTAAATTATGCTTGAGGTTGTTCTTGATGGTCTTCGATCTCTGTTT
TCGTATTGCTTCTTGCAGGTGGCTCGCTTTCGTAGCGGCAGGTGCTTTCCATGGGTATTTTGCTGTGCTAAGACTGGCCTTGAACGCTATACCTTCTCGA
TTCTCCCACGCTGCCCAGTTTGCTGCGTCCGCTGTTTTCCCATATTCTTTTGACACCGACGTGATCTTCCAGTCCCATCCATTGGATGCTCTTGTAAGTG
TCATGACTGTGTCCCTCGCTGTACCCCTTCTTGCTCTTACTACTGCTTTGTTTACATTATCTATCCCCCATTTTAATTTTTCTTCTAGCTTTGGGGTCGT
GAATGGTTCTAACTCTTTTTTTTGTGGGTTCCCAGCATCGTTTGGGCAGACTAAGTAATAAGCTTCGGCTCCATCTGAGTATTTGCTTGTGTTGACGAAG
CTTGTAGATCTGCGCTTGAAGTGGTGTTTTGATCACTGTACCGTATTCGCCTGCTGTTGGCAATCCTAGTTCCTGCTTGACCTCAATGTCTTTGAGCTTC
GCTGACTGCAGCGCTGGGAAATCTCGAAGTCTGAGTGGTCTCCCATGCGAATCTAGTATACTAGCGTTGTCATGCCAGGTTGTGTTCATCAGGAATTCCG
TCATTCTGGCTGTTACCTTCTTTTGGTTAGCTTGCGTTGATGTAAATCGCAATTGTTGCCCGTCAATCCAGTAGCCGGAGCTTATAGCTGGTCCTTGTTG
TTGGCGTTGTTTGATGTCTTCTTTTTCTTCCTCGTTTGGAACGAATTCTTCAGAGTGCGCCCACCACAATTCTGCTCTTCCCAGCGCTTGTGCTGTAATT
TGTGGCATTTTTTGCTTCTCTCTCAGACTTTTGGTAATCATTTCAAGACTGATTGGCTGAAACAAACAGCAGTTCGCCGCGTATACGTGTTCTGGATGTA
CCGCGTGATGCCAAGCGACTGTGTATGCATCTTGGGGTGCGTTGATCCATCTTTCCGCTAGATTGGCTCTAGTTACTCGAATTGCTGTACTTATATCTTG
CAGCCCCAGTCCCCCATATTATTGCGGTGTGAATAGAAGCGCAGGATTAAATTTGTGTCTTGCCGTAGCTGTACTAGCAGACCCGTACCACACAAACTGT
TTCTGTAAATTCTCCAATTGCCGCAGGGTCTATTTGGGTGGCACTATCTGTTTCGCGGTATATAAAATTGGTGGCAGTGCTACTGCGTTGAATAGCTTGA
TTCGTTGTGCGATTGAGTTGCTGATAGAAGTAGCGATTCTGAGTCTTCGTTGAACTTTTTCGATTCGAATATCCCAGTTCTCCTTAATTGATTCTTTGTT
TCCCACCCAGTACCCTAGCTGCCGTGTTGTGCTAGCTGGGTTCAAGACCGGAAATCCGTTTCACTTCGTTGGAGTATTGTGCGTGTTGAAGCCAATCGTT
ATACGTTTGTGCGGCTGGACTTTGAGTCCTGAAACCCGTCCGAAGTCTGACAGTATCTGCTTGACTATGTCCAGTTCTTGCAAGGAGCTCATAAAAATGG
TGCTGTCGTCCACGAACGCTGAGAATTTATGACGTTCATCTTGGCTGCCTGGTACTCTGATTCCTTTCAATTGTGGGTTCCTGTTATTGAGTTGTCCGAG
TGTATCAACCGCTAGTATAAAGAATAGCGGTGCTAGTGGACATACTTGCCGAATTCCAGAGCGTACGTTCCATTTTGATGAGAGATTTCCATTCACAAGA
AATTGTGCTGAAGTTCCTTCATGCAGAGTGCGAATTACTTTCAGAAAGTTATCCGAAAACCCATATGCCGCTAGTACACATTGTAAGAATTTGCGATCCA
GCGTGTCATATGCTTTCCTGAGGTCCAAGCAAAGTGCTGCAGCTGAGGCTGCCCATTTCGTTTTCAAGACTCCCGTACTTGTTTCCAACATACTTCGAAG
CATCATGACAGTCTTATCAATGCTGCGTCCCCTTACGAACCCTTGCTGCGACTTGCTGATTAACTTTGGTAATATTTGGTGTACCCGTTCAGCTAATATT
CGTCCGAATAGTTTGTATGCTGTGTTGAGTAGTGCGATTGGGCGGTAGTCCATGGCTTCAGCCGAGTCTCCATTTTTTCTGAGTGGTATAACCGTAGCTG
CCAAGAACGATTGCGGTACTCCTGCTCCTTGAAGAATGCTATTGAATAATTTTGTTAGAGATGGTATCATCATTTCTGCAAAGTCCTTGTAAATTTCATG
GTTGAGTCCAGTCGTTCCTCCCGTTTTATGTCGGTTGAGGTGGTCAATGGCGAGTTTCGTTTCTGTTTCCGTGATTGGGGTCATCAGATCTGCTCCTTCT
GTCGGCGTTAGTCGTTGTTGTGGTGGTTTGTTCATGAACTGCTCCATCATCATAGGGCTGCCTTG