Description :
From Genome Similarity Track
Location :
Scaffold_2492:56- 2442
Sequence
2386 bases(100 bases per row)
GCGAAGAACGTGCTTTGTTGTGTGGTGTAAACAAGAAGATCCAAGCCGGCAACGAGCTTATTCAGGGATCTATTCTGTTGCCCAACGCCTCCACAGAAGA
AGAGGTATGCTTTTATTGTGAAGACAACACTAGCTACACATCTACTGACCAGTTTTTACTTTTATTTCCACAGGAAAGCAACGACCGCGAGAAATTTTCA
TACCTCCGAGAATATCTTATGTCTGTGGATTCGCTTGACAGCGTACGTTGGCAACAGGTCTGCTTTAGTAGGTATACGGTGCACTTACGTTTGTACCTAT
TTGTCCGTGAATGGTGGATGTTCTCCCGTTACAGCGCGAGTCCCAGCACATTGTCTTCATGCTGGACCCGGAGTCCAACCAGTTCACGTACAGTGATGTT
CTGAACCGTATTCAACTCAGAAAAACGAAGGTATGTGAAGCTGAGGAGGAGTTGAACTCCTCATCCGTCGTGGACGACGCGGTCCTAGAGGACACCAAGA
CGGCGCTGAGCGCAAGAAGTGGATCGGCGATCCTCAAAGATCCTTCGGATCCCTTCTACCCGGTGGTGAAGGAGTATCGAGACGTTGTCTCAAAATACCC
ACCGACGGGCCTGCCTCCGGATCGAGGCGTGTGTCATGAGATTGACCTGGTTCCTGGAACCAAATACTGCGTAACAAGGCAATGGCCTTTGCCGAGAGAG
CAGTGTGACGTCATTGACGCATTCTTCCGTGCGAAGCACGAGGCAGGGATGGTGCGTGAGAGAAAGTCTCCGCACTCGACACCCACGTTCTGTGTCAGAA
AGCCGAACGGCAAGTGGCGCATTGTTCATGCTTTTAACAAGCTAAATGCGGCCACTATCCCGGCGCAAACGCCGATTCCTCGCAAGGATGTTCTGCAGAA
CAACATGGTAGGCTGTACGCTGTACAGCGCGCTCGACTTGGTCGATGGCTACTACCAATTGCTCATGAGAGCGAGCGACATTCCGCTGACAGCGGTGAGT
ACTCCGAGCGGTATGCTCTGGGAGTGGCTGGTGATGCCCCAGGGGCTGTCGAACGCACCAGCAACGTTCAATCGTCTTGTGACGCAGCTGTTTAGGCCCC
ACCGGGCGTACGCTCAAACGTACTTTGACGATATATTCGTCCATAGTCGTGCCGAGCACGGAAAGTCAGACGTGGATAACCACATTGACCACTTGCGAGC
GGTGCTCGAGTGCATGCGCACTAATAAGTTGTATGCCAACTTGGACAAGTGCGTCTTTGGCGCGGAGGAGATATCTTTCCTCGGGTGCTTCATTGGGAAG
CGTGGCTTAAGGGCAGATCCTGCCGAAGTCAAGGTCATCGTGGACTGGCCGGTTCCCAAGAACCAAAAAGACTTACGCAAGTGGCTAGGCTTAGCCAATT
ACTTGCATGAGTACAGCGCGAACTACGCGGAGATGGCTCGGCCATTATCAGATCTTCTTAAGAAGGACGAGCCATGGTGCTGGAAGGTCGAGCACGACAG
AGCCTTTGAGGCTGTGAAGGAGAGCCTCCTCCAGGCTCCGATCCTTGCGCTACCGGACCCGGATATTCCGTTTAGCATCGTCTGTGACGCCTCCGATTTT
GCAATCGGTTGTGCTTTACTACAAGCAGACGCCGAAGGGCGTGAACGCGTGATTGCGTTTGAGTCTCGCCAGCTCAAAGCTGCAGAGAAGAACTATCCAG
TTCATGACAAAGAGCTACTTGCAATGAAGTATGCTCTAGTCAAATTCAGGGTACACCTGCTAGGCTCTAAGCCTTTTGTGATCTTTACTGATCATGCGTC
GCTACGCACTGCGACACAGTTGCCACATCTCTCTCAGAGAATGGCAAGATGGCTTTCCTTCTTTGCCGAGTAAAACTTCGAGGTGAAGAACAAGCCGGGG
CGGCTTAATGTAGTGGCCGATGTGCTCTCGTGGAGGCCGGACTACGAATTAGCTCATGTCACGACAGTGACGTCGTCAGTGCCTGACTTGATACGCAGAG
CGTATGCACAGGACGACATGTGCGTAGCGCTGCTACGGGCTCTTGGGAGCGAAGAGTTTAAAGACTCTGACAAGAAATTATCCGAGCGCTTACGCGCGAG
GCTGCATCGATACTCGCTCGATGGTGGCCTGCTGTACTACAGCACCGACTCTGAGTATAACCCTCGTGTAGTCGTTCCTCATGATGAGGATCTAAAATAT
CGAATCCTCTTTGAGGTTCATGATACGCCCATGGGCGGGCACTTAGGTCGGGAGAAGACCTATGGCTCGGTGAGCTCGATGTACTGGTGGCCCAAGATGT
ATAAGTGGGTCGGCACCTATGTACGCACGTGTGAGACGTGTCAACGGACAAAGTCCGCGCCGAGCACGGCAGCGCCATTGGCGAGT