Description :
From Genome Similarity Track
Location :
Scaffold_3504:56- 2334
Sequence
2278 bases(100 bases per row)
TCGCGTTTATTCGCCGCTTGCGACCCGCTAACAAACACAAGCGAAGATTAAGCCGAAACGCTATGCATTTGCAGAGGCACCCGCTTAAGCCAACACCGTA
CCTAAACTCAAGCCCGCTAGTCGAAGAAACAAGAAAGAAAACGAAAACGAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAA
GCTGGATCCAGGTCAAGCTGGTCCGACAAGGATCTCGAGTTTGTGTATCGCCACCAAGCTCTACGCGATTTCCTGCATCAAGATCCTGTCATGCAGATCC
TGAATCCACGACAGATCGAAGATCCAAGGGAACCGGTGGGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAAGATCTATTACGTCTGTTTAC
GGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAGAGGATATCTTCGAGCTAGACCTGGATCTCATAGTATCCGCGACGCGGGACCTCTTTGCCAGAGTT
AAGTCCATCACCGGAGAAAGGTCGCGTACTATGGATCCAGTGTCGTCACCGAGGATCAGCCAAGCTGCGTCCTCGAACTACGAATCCGCCGCTGAGGATG
AGCCAGATACGTCGTCCGAACCACGACGCATGACTTTAGGACCCTCCGGGGCATCCATGCTGGAAGCGCGGGCGAGGATCCGAGGACAGGAAGCCCCTGT
GAAAGCGAAGGCTCAGGACCCAGTACGCCCTACGCGTGATCTGACACAATCCAGCCAGGATCGAGCCAGATCCGGCAAGAAGCCAGTGGGGTTATCGTCA
GATCGGGCTCAAGGTAACCGCCTCACGGATCCTGTCTCGCCAGTGGAACAGACGGCCACAGGCTCTTCCGACACTTCCTCGGGCACCCTGCAGCGACACT
TCGAAGCCGCGATGAGTCGTTTCCTGGCCGAACAGGGTATGAGAGCGCCCGTGCCCCAAGTGCAAATGCTTCACGAACATGGAGCACGGGACGTGGAGAT
GGAGTCAGTAGAGGGGGACAACTCCCATGATGAGTTCGACCCAGACGATCTGGATGGCCCATCCACTTCGGCAGCCGTGGTAGCAACGGCCACAGCCGGG
GCAGGTAGATCGTCCATGATCCAGAGGGTACGGATCTCAGCCATATCGGACTTGAAGGAGTTCACGGGCAAGGATCAAGATGAGGACCGAGCGAGAACAT
GGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGATCAAGCGTCGGATGCTGAGAAGTGTCTGACCTTTGCGGATCTGCTAGCGGGGCCAGCCAGGAACTG
GTATCGGCAGCTGGGCAGATCAACCAGGAACAAGTGGCCAGATTTGCTGCGCAGTTTCCAGACCCAGTACTGTGGATTGGGAGTGTCGGTGGCACGACAA
TACTACCATGCTCGCCGCAGATCGGATGATCCCCGTTGGATACCTACATCGACTAAAGTGGCCGTCTACGGCCAGTGAGATCAAGATGGGGACCAGGTAT
ACAGGAACAGTGATCTTTCTGGGACTTGGGAAACGGAGTTTTGGGCGAACAGGCGACCCCTTTTAACTTTTTCCAGAGGACAGAGAGCTTGAAAGAAGTG
CTGCGGGCTATGATTCGCCGCGAAAAACCCCCCCCACAGAGAGAGAGGCGGCGGTCGGATCCGGCAAGTATCGCCAAAAGGCTCCGGCGCCTACGGTTCC
AGCTCGACGTGTCCACCAAGTCACGGCGCCCGACTCAGGAACTGAATCAGGATCCGACGGCTCGGACTCCGACCCAGAGGATTACCGTCGAGTCTGTCTC
ACGGCATCCAACGATCGAATGGCGAAGACCGGAGACAACTCTTGACTGGGGGATACCGTATCCGGGGACCGTGGGATGTACAGATCCCGAGATCTCATGG
ACGGGACAGCGCCAATCAGGTGTTCGCAGTGCGGATCCCGGAAGCACACAAAAGCTGGATATTGGAAACATCTGGTTTGCGAGAAGTGTGGCAAGAAAGG
TCATCCCGGAGATCATTGCTTTTACGTATGTCGCGGTTGTGGCGAAATTCATGACGTCGGCAAGTGTCCGATGGAAGAATTCTACAACCAGATAGCCACC
GAATAGATCCAGCCAAGCACAGAGGGATGTTGCCAGAAGTGGCCGAGAAGAGGTTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGT
TCTAGGTATTGCATTTATGCATTTGTGAACAAGACATCGCTCGATCCAGGTAGCAGGACCCTAGATCCAGTCGATAAT