Description :
From Genome Similarity Track
Location :
Scaffold_3753:56- 1938
Sequence
1882 bases(100 bases per row)
CCGGGTTTTTCCCAAGGGGTATCAGGACGGGCCACCAGGTTTTACAGAACAAATACATTGGGGCCCCCCTGCAGCGAGATTTTGAAAGCTGCGATGAGTC
GTTTTTCTGGCCGAATTAGGGTATGAGAGCGCCCGTGCCCACAAAGTGCAAGTGCCTCCACGAACATGAGCCACGAGACGTGGAGATGAGTCCGTGGAAG
GGAGACCACTCCCATGATGAGTTTCGACCCAGATGATCTGGATGGCCCATCCACTTCGTCAGCAGTGGTAGCAACAGCCACAGCAGGACAGGTGATGTTC
CATGATTCAGAGGTACGAACGCAGCCTAATGAATCTGAAGGAGTTCCACGTTAAGAATCAAGATGGAGGACGGGGCGGGAAACATGGTTCAGCCAGAGTT
CAGTTCGCCCTTTCTGAGAGATTCAAGCTTCGATTGCTGAGAAGTGTTTGACTTTGGCGTTTTTGCTAAGCGGGGCCACCCAGAAATGGTTTGGGGCAGC
TGGGCAGATTCCACCAGGAAACAGGTGGCCCAGATTGGTGGCGCATTTTCCAGAACCCAGTACTGTGGATGGGGAGTTTTGCGTGGCACACATAATATTA
CCCCCCCCCTTCGCCGCAGATCGGATGAATCCCCGCTAGAATACCTACATCGACTAAATGTGGCCGGTCTACGGGTCAAGTTGAAGATCAAGGATGGGGG
ATCCAAGGTACTGCGGGAACACGTGGATCATTTCATCGATACGTTGGGAGACGTGGATCTGGCCGACAGGCTGACCCTGTTACGACTTCCCGACACAGAC
GAGCTTGAGGAAGTGCTGCGGGCGGTGGATCGCGCGAAACACCGCCAGAAGAAGGCGGCGGTCGGATCCGGCAAGTATCGCCAAAAGGCTCCGACGCCTA
CGGCCCCAGCTCGACGTGTCCACCAAGTCACGGCGCCCGACTCAGGAACTGAATCAGGATCTGACGGCTCGGACTCCCACCCTGAAGATTACCGTCGAGT
CTGTCTCACTGCGTCCAACGATCGAACGGCGAAGACTGGAGACAACTCTCGACCGGGGGATACCGTACCCGGGGACCGTGGGATGTACAGATCCCGAGAT
CTCATGGACGGGGCAGCACAAGTCAGGTGTTCACAGGGCGGATCCCGGAAGCACACTGAATCTGGATGCTGGAAACATCTGGTCTGTGAGAAGTATGGCA
AGAAAGGCCATCCCGGGGATCATTGCTTCTACGTGTGTCGCGGGTGTGGCGAGATTCACGACGTCGGCAAGTGCCCGATGGAAGAATTCTACAACCAGAT
CCGCCAATGGTTTGATCCAGCCAAGCACCGAGGGATGTTGCCGGAAGTGGCAGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTACGAG
CCGAGCGTTCTAGGTACTGCATTTATGCATTTGTGAGCAAGACATCGCTAGATCCAGGTAGCAGGACCCTAGATCCAGTCGATAATACACGTGATCTACA
TGAAGTGTCAGTTGCCAAGATCTCTAGTTTGCGCCAAGTGGATGAGTTTGCCAGATCCGAAGTCTCTTCAACCCTGGATCTACAAAGGGGAGAGGCACGT
GGTTATTGGGAGAAGCGCCAACATGGTCGATGGTTTGAGCCTACCAAGGGTGAGGTCACTGCAGATCCACCTAAGGTCTGTCAGGTCACTGGAGGATGTG
GGATCCATGTATCTGCTAACAGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAGGAAAGTGGTTCAGACAAGCCAAGGTTGGGGGCAAGATCAACA
ATGAAAAATCAATCCTACTTCTAGATAGTGGTGCCGAGGTGTCTATACTGGATACCGCCTTTGCTCGTAAGGTTGGGTGCCA