Description :
From Genome Similarity Track
Location :
Scaffold_3149:56- 1172
Transcript NameFunction/comments
Phypl_g15649hypothetical protein

Sequence
1116 bases(100 bases per row)
CGATACTCCCACGAAGATCAAACGACGGCCTGTTCGAGGGGAAAGCCAACCGAGCCAGCTAAACACCAATCACAGTGACGGTGGTGAAGACTCAGCGATA
GAacacgagctggtggaaTCTTAAGCTGCAGTCAAAGGCTCAGCGAGTACATTCGGGCTCGACCCAGCGATCGCAAGACCATCTCTCCAGACTTTCACTT
CGGAAGAGGACTCAGCGATGTAACATGGGGGTGACGAGACAGCTAACCAACTAGAGTCAACACCTGCAGCCACGCtcgacgagaagaacggcatGGATCC
GCCCTTGAGACTTGGAGACCAACTGACATGCAGAGGCGAGAGCTCGCGGGAGAAGGTCCCCATCCAGATGGACAGGGGTGACCTATGGGATCCCGGCAAG
GTGTGCTCAGCAAGGTCAGCTAACTCGGCGAGTGGTGATCAAGGACCAGTAGCCGTACCCAGCAAGAGTCCAACCGAGCGAGTACCACGTCGTCCCGGAC
TCATCGAATACAACGAAATCGATGCCGGTGAAtactcgctgagctcggATCTGGAATAAGATCTCGAGCGTCGTTTCCTTAGCGCCGTtcaagagctcga
cgagagTACCAAGACCCTCATCGAGTGAGTCGAATCGTCAGGGCTCACGGATGAACACCCGTCGAGCGATGAAAGCTTGTACTCCCACGAGCTGGCATTT
TTACCCGACTTGAGAGTGCTGTCGCCGACAGACTTGGATTATGCGGGAGATAATGCCGTGGCATCGGCCCACAGTGAAGGCCAGCGAGAGTAACATATCC
AGACCCTGACGACTCACAAGCAGATTATGATTTCGAGTGGAAACGCGTTACCACCACCTGCCTATGGAGTTGTGTGTGATATCGACGTTCAAGGACATGA
ACCGATAAAGCAGAGAGCCCGTCGAGTGCTTTTACGACACCTGAGCAAGCTCTACGAGCTACTCAAGAGGCTCTTGAAAGCTCGACTGATTTTGCTTTCG
CGGAGTCCATGGGCTTCGCCTATTGTGATTGTGCTCAAGAAAAATGGAGTGGGTATTCGACTGTGTATCGATTACAAACTGGTCAATGCCGTCACAGTGG
GCATGGGGTATGCCAT