Description :
From Genome Similarity Track
Location :
Scaffold_1474:56- 1165
Sequence
1109 bases(100 bases per row)
CACCGGACGCACGGCATTACACTCGTAAGCGTAATGCCGGTCTTCTGACAGCGATTGCACTTCTGCAGCCGCTTGTCAACGtGAGGGCgAGGTTGCTCAC
TCTCAGCGTACGACAGGTtcATGGCCTCTGGACCTGATCTTGTCGTCTCGCAGGACGaTAAGATGCCGAATGgAGtGcctgcTTGCGgCTAAAACCCTCC
TCCATCGCAACTACGATCGCCTCGTCGAGTTTTtCACACTTGACGTGAAaGAGATGCGTCTTGATCGGACCATCTTCAAGCCCcTTGATAAaCGTAATGA
CcTGAGTTTGTGGGTCGATGGGgTTCGCCACGGTACAGCTCACGAGGTATCGGgCGTGCTgagCGTAAGCATGAACATCATGCATACCCTGCTTCAAGtc
cAGGAACTCGGCGCGAGCCCTGAACTCCGCGTGAGGAGGCTCGAaCGTCTATTGGAGCCTGGTCTTGAATTCCTTTAACGGTCCAAAACAATATGGATCG
TGAaagTTGAGACCCAAgCCcAAGCCTTGGCGCGTCCAGCCAGATTGGACACGGAGAAGGTTACCTTCATCGcACCGTCCTCAGTGCGACGAGCTCGATG
GTATCATCGAGCTCAACGAACCAGCGCAAGGCGATTTCGCTCTCAGCGGCCTTGTATTTGGAGATCTCgATCTCCAAGGCTTGACACGTCTCGTGCAAGC
TGTGGTAGCTGCAGCAACGGACTGCTGCTGCTGTCTCAaCAATTCTATCaGTTGAGCGCCTTGCAGATCGGCCTGCTGAGCTGCTTGCTGTTGAAGCGAA
GCGAGGGAACCTCTCGCTTCGTCCAATTCATGTTGAATGAACTGGGCGATACTATCGTgTTGCTCATCAtGCGAGAGCGATAtgAGCATGACACCTACGG
CAGCGTCGCCGATGGTCCTGGCCATGTGTTGCACCGCCTGCCACTCAAGGTCGCCCTAGTGGAGGAAGTTCTCACGCGAAGCGTGATGattttGCAGACC
TGTGGTTTCCGACACAGGAGTGTTCATAGTCGTTGGACGGACTACAAAGCGCTACCAGGTGTAACGAGATGACTCATTACTTCACTTACACCGTGAGCAG
TGTAGGAAG