Description :
From Genome Similarity Track
Location :
Scaffold_4074:56- 1094
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_4074-snap-gene-0.1ATP-binding Cassette (ABC) Superfamily

Sequence
1038 bases(100 bases per row)
ACACCATGCACTTCCTGACCGTCATCTTCGCGCTTTCTGCTGCGGCCGTGAACGGTGGAATGTGCGACAGCCACCTGGGCGACGCTGCTACCGAAGAAAC
CAAGTCCCTCGGCCAACTCTACCAGGAGGCCATCAACGAAGGCGGGAAGCTGGTGTGGTATGCTGGCGGAGACACTCAAGACCAACAAGACTCGCTCAAG
GCTGCTTTTCTTTCCGCGTTTCCCAAGATCAATCTTACGCTCGTGATCGACTACAGCAAGTACCATGACGCTCGCGTCGACAACCAGTACGAAACCAACA
GCGTTGTCCCAGATGTGGTCTCGCTCCAGACGTTGCAAGACTTTCCTCGCTGGCAGCGTGAGTCCAAGCTGCTCAAGTACAAGCCCGCTGGGTTTTCGCA
AATCTACGACGGGTTCAAAGACCAAAGTGGCACCTGGTACTCATACACGGTCTTTACATTCAGCTTTGTGTACGACACCAAGTTGTTGGCAGGCGAAGCA
GCCCTCCAAACGCCAGTTGATATTCTGGACCCCAAGTGGAAAGGCAAGATCTCGTCGACATACCCACACGATGACGACGCGGTACTGTTCTTGTTCAAGC
TGTACGTAGACAAGTTTGGGTGGAGCTGGGCCGCCAAGTATTCCACGCAGGACGTGGACTTTCACCGCGGCACCGATTACCCATACAACGCCGTCACTGC
TGGTGACAAAGTCATTGGAGTGGGTACCTGGGGCAGTCTTGTTCCGAGTAACTCGTCAATTGTGTACGTTGGCAGCTCCAAGAGTCCATACGTTGCTTGG
GGGCAGCGTATCGCGATCTTGAACAAAGCGAAAAACGTTGCGGCCGCCAAGCTATTTGTCAACTGGCTCGTTGCCACTGAGACCCAAGAGCTAATCAATT
CCTCTGGCTGGACCGTTCGCAAGGACATGAATCCACCAGGTGACCTCAAGCAGGCGTGGGACATCCCCGAAGCGAACGTGGAGGGCTTTGTGCAATTCAT
GGAGGACCGCGAGCGTGTCGAGCAGTGGAAGCAAACGT