Description :
From Genome Similarity Track
Location :
Scaffold_70:55996- 76016
Transcript NameFunction/comments
Phyta_totarag2852hypothetical protein
Phyta_totarag2853hypothetical protein
Phyta_totarag2854hypothetical protein
Phyta_totarag2855hypothetical protein PHYSODRAFT_320443
Phyta_totarag2856conserved hypothetical protein
Phyta_totarag2857hypothetical protein

Sequence
20020 bases(100 bases per row)
ACAAAGACACGAAGTGAGCAAGTGCTTCCGTCGATCCAGGACCGTATTACAGTTTCCCCTCCTCCGCACCTGGCAATGACGGAGCCGTCGGGCCGCAGCA
TTCGCGGATTTCTGGCGAGTCGCAAGCACAGACGCCAGTCTTCCGACCGCGCCAGCGCTAGTATCACCAGCAGCGTTACGTCCTTGCCCGAGACCGCCGT
GGCCATGGAGGGCGCACTCAAGAAGCGCGCGGCCAAGATGCCCGTAATGCACGACCGCTACTGCGTGGCCACGTGGGAGCTGGACGCGGACGAGCGCAAG
TGTGTGATGCTGCGCAGCTACAAGAGCCGCAAGGCGTACGACGCGCACCCGGAGAAGCCGTCGAGCGTGCACCAGCTGAAATGCATCAGCGACTGGGACG
GCAAGACGGGCTTTCACCGCTACCAGCATGCGTTCACGATGGAGACGAGGGACCGGAAGCTCTTCCAGTGCGTGGCGCCCTGCGCGGccgacaaggacaa
gtgggtggagctgctggccgtccAGTCGGCCTTCAACTCCGGCCGTGACGCGCGtctcggcagcgtcggcagtcTCGTGCCACTGCGACGCACGCAGAGC
GTCGAGTCCGCGGTGGACGGCGGCAAGCCCAGAGCGGACACACGCGTGTCGGTGGACAAGACGAGGGCCGAGAGTGATGACGACGGTAACGCCGACCAGT
CGACCGACTCGGAGGAGCAGGTCGGCAGCATCTTCCCCGGCCGCGACGGCCTGTTCCGGACCACGTCGGGCGCGTCGACCAACTCGTTGGAGCTGCCCAC
TGGTGACAAGAGCGAGCCGGCCGACTGGGGTCTCTATGGAGAGGGCAATGGAGACGTGTCGTCCTCTAAgtacgagctgcaggaggatGCCAggcctgtg
ctgctgctggacaaggagctgctggacgcgcgcggagagaccaagacgctggcctCCGACCAGTTCCTGTTTGAAGAGGCAGGCGCCAGTCGGTTCGGCG
CCGTGGTCGTGAAGGGGAGgggcgaggaagaagaggacgacggcgagttcatcgacgaggagtTTGCCGCACGCGAAGCGCAGaaggagaacgagaagaa
catGAAGCGCCGCGCGCAGAAACTCGAGTCCAACCGTGACCTGTACGCCGAGATGGCGGCCGCGAGACTTGCCGGCATGCGCAAGGACGCGCGCCACCCG
AAGAAGCGCCATAGTCACAGTCGCAGTAGACCGTCCGCTGGCAGTGACGAAagcgacgtggaggagcaCGACGAAGACCAGTCGGTATCGTTGGAGGCCG
ACGTTGAGAGCATTGCCGAGCTGGAGGACTGGAAccagcgccgcagcagccgtcGCAGCTCCAAGAGCCacaagaagagcttcatgagcagcagcgagaa
tACCAACAGTATGAATGACGGATACGCCAgtgaagaaagtgaagaagtggaagaagaggagcaggaggaggaggcactgccgattgctgctgctactccT
GAAGGTATGGTTGAAGCGGAGAGTGCAGATGCTGAAATTGCAGAGGCTGAGAGTGCAGAGGCCGAAGAGCTGCGccaactgaagaagaagtaccgCGCCG
AACGCCGTGCTAAGAAGCGTCTGatgaaggaagaggaggaggaggaacgcATTGCACTGGAGGCGGCAGAGCTTGCGCGAGCCCACcgcgaagagcagcg
agctcgtgaggaggccaaggctcgggaggagcaggagaagcgcGACAAGAAGGAACGCcgcgagatgaaggagaaacTGAAACGCGAAAAGGCCCGACAG
CGTCAGGCTGAGGCTGAGCTCCggaagctggtggagctgaagcaggcCGAGGAGGAACGTCGTGAGCGCGAgcgcaaggagaagaaggaaaagaaggaca
agaagaagtccaagaagaaagagaagtACACTTCACCTGCCGAGCGTATCCacaagaaggaagagcgCGACGCCGAGCGTGCTGCAGagttcgctgctgc
cgcagaagctgaagctgaggTCTCGAGCGCCCTGGTTGTCGTGGAAAAGCCGGAGAGAGCGGTACCAGCTCAGCAGCCGCGTGCAGCTCCGGAGCCCACT
TCGACGCCGGCCCCAACGCCGACTTCTTCGTTCGTCCAGACCGATACTGTCCCGGTACAACAGGTTGCACCcgcacctgcacctgcacaTGTTCCTGCTC
CTAttcctgctcctgttgctgctcctgctcccgcttcttctcctgccACTGAGGgtgcagccgccgccgcgcaggcgatgccgatgccgatgccgatgcc
gatgTACCAAATGGCCCCGCCACCGTTTGTGCCATCGTATCCTGTTGGCCCGCAGAGCATGCCGGCCTACGGTCTGGCGGCCACCTTTGGTGCTTACCCT
CCGTTTTACCCTGCCCCGTACAGCTACGGAGGACCCGTGGGGCCGCAGCCTGCGTTCACGCGCCCGAACATGGGGTTCGTGGCCGGACTAAGCGCGATGG
GTTCGTTCCGCACTGCTGGTCCGGAGTCGGCATCTTCCAGCCAGGATTCTGCTGAGCCCATGATCGGCCCGCAGCTCCCTACCCCGGAAGAGCGCGCTGC
TACCTCATCGGCAGGCGCGAGCGCACCTTCCTTCCCGCCTCCGTCAGCGATCAAGTCGAGCGGCGTAAAGCTGACAAACCTGCCGGAGTTGCCGGATGTG
ATCGAGTTTtaggaagatgacgatgtGAGTTGCTCTCATTCGAGAGACTGGTTGGTTCTAACTTAATTTGCAAACATTTTTTGCCCCATTCAACGTGGTT
GTCAGTCCAGTCCGTTGAAGACACGACCCAGAGAAATGAAAATCGCTGGCTGATCCTCAGAGGCgcaggaagtgctgctgaCTACGAGgtcgtttttttt
ttgtgACGGACGGACGGGAATAAATACTGCTGACAAGGAGGGGTCTACATTGTAACCTGCTGCGTATTTCACCTGGAAGGTCTCAATCATGCACGTGGTG
CCGGTTCCGGCGGTGTTGCGGCAGTCGAGCCGCAGCCGCCGGCGGTCGTCGGTATCGCGAACACCGAGTCGACtgacgttgttgctgcttcgtcaacGCG
GCCGTGCGGGCTCGTCGGAGTTTCTGATGGCTGAGAACCTCAACGCGTTCGATCCGAGCTCTCGCTTCATCCGAATATGCCAACAACTTCGACTTGCAGC
GAttctcctcgagctcgtgtCGATCCCATTCCTAGCGGCGTTCCACCCGGAGACGACACGATCTCAACTCGCCGGCGTGTACGTGTGTGAACTACTTTTC
TGCGCAGATATCTACGTGCAGCTCAACACGGGTTACTACGAAAATGGCAATGTGCTTCGAGATGCACGAAAGGTTCGACGAAAGTATCTGTCGTCTTCAG
GATTCCTGGCGGATTTAGTGGCACTCGTCCCGTTGTCTCTACTGCTGCCTGCGGAAGCGACCGGAACGCGGTCAATTGCCTTGTTGGAAATGCACAAACT
TGTGCGCATTTGGCGTCTACCAGCCCTCACGTCCAATCTCGACGACCTCTACGCAAGGCATTTCGCGTCGCTTAAGCTTACCAAAGTGCTCGGGTTCACG
CTGCTACTGACGCACTTTGTGGCTTGCGGACGCTTTAGCTTTGGCTACGACCATCCAGCCCCCGGCGAGGAACCAAACCACTGGCTGCCCCATGCTCCAC
ACGAAGGGCATCATACTGCACGGAGACAGTATCTCATGTCGCTCTTTTGGGCGTTCGGACTACTGACTGGGGGGTTTGAGGGCGAACTGCCGCATCATAA
CGCGGAGTTCGCGTTCACAATCGTTGTTGGGCTGTGTGGGTTTACACTCTTTACAGCTCTGTGCGCAACCTTCTTTCTGCTCTCCAAGTGCGAAAGCGGC
GACGCGGAGCTGGCCGAGGCGCGCGTGCACCAGTTCCAGCATATTTTGGCGTTCCACCGGGTTCCGGCTCAACTACAGGCGCAAGCTGTCGACTACCTCC
AGCGATATCACACCCAAGCCGAGGCGAACGAccgtgaagctgcgcgtcGACTGTGCTCTTCGATTTCAGTCGATATCCAAGTTGGGCTTCTCGAAGCCAC
CGTCGCGCTGGTGCCGGTGTTTGCCGGGTGCGACTCCCTCTTTATTCGAGCGGTGACCCGCCTGCTTGAGTTGATCGCTCTACCGGCGCGTGTTCCTCTC
TTTCGTGCAGGAGACCATGGGAATGCAATGTACATTGTTCACACGGGCGTCCTACACACTGTAGTGGGCGGGGTCAAAGTGCGCGAGTTGCGAAAGGGGA
ATTTTGTCGGTGAAGTTGCGGTGTTTGCTCGACAGCCACGCACTGTGACTGTGATCACTGCGACCTATTGCACCTTGTATCGATTGTCGCGTGCTTACGC
TGACAAACTGCTTGAAGGTTACCCGCAATACACCCAAGTGATCAATCGTACTGTTGCCGAGATGCTTCAGAAAAATGCTGTGGAAGTTATCCCCGTCAGT
ATCAACAGCCCCCGACAAGAACGTGAACCTAGAAAGGGTTTGGCGCTATCGTTTTTACAGCTTGTTCGGCTCAAACGACTTGTACACGCGCGCGTTCTTG
CAAGAAAACGGGGCCGACAAAACGTGCTTGAAGGCCCCAAAAAGGCACATGACTCTGGGGTGGTGGGCCAAAACAAGACTGCGGaagcaagtacatgtac
tcccCAGCCACCTCTTTACTACCCACCTCCGCAAAGATTGAGAGACGCTCGCGTTGCGTCTGAAGCTGCTATGGGCCCGCGGCACTCGGCGCCAGTACCA
CCTCCATCGCAAAACTTACACAGCGCCAATTTCCACAGTGATAACCGCTTGTCGCGATCGAAAAGTGCGTCAAACCGCACGTCGATCAAGATATTCCCTG
TGCTCCCTGGAGCCACGCCTGACGTTAGTACTACCGCGACATCGAGATGCTCTTCATTTCTTGCAAACGGGATGACTCGACTCACGGTGCTTCGCGATAA
CTTCTTCCACGATAACTCGGTTAAGCCTTCCGACGTTATCCAGGGTTTCTACGAGCAGTTTCCGCATCTTGCAGCATCGTCCGCACCGTGTCAACGTTTG
TGGCACCACTTCCTTATGACTCGTGGATTAGACACCGAGTCTAACTGGAGGATGGCGTGGATTGCTCTCGTCGCTGGTGTGACCTGCTACAATTGGGTTC
TAATCCCTCTCTTGCTATCGTTTTCGGCCCTGGATGGACTGTTGTCAAGTTGGTATCTCATCACGTTAAATCTTCTTGCAGATCTCGTGCTTTGGGTAGA
TATCTACGTCAGTTTGCACCTGTCGTTCACTGTGAACTCCGAGAAGATCGTAGAACCGAAGCGGAGTGCTGAGCGCTACTTGTCAAGTGGAAGGTTCGTA
CTCGACCTAATGTGCGCGTGGCCGTATTGGATGTTTTCACCACGCAGATTTACGTACCCCGCGCTGCGTATTCCAAGACTGATCGGTGGTTATCGACTGC
ATGGACTGGTtgctgaagtcgaagccTATTTCCGCGTGAACAGCCAGCACAAACTCATGCTGCTTGGGATTCTGTTCCTAATGCTGTACCATATCGTAGC
GTGTTTGTACTTCAGCACTACATATCTCGACGGATACAGCACGGGTGAAGATAAATGGCTTCCGTCTGATGACGTGTACCTTCACCGACTAAATGCAACT
CATTTTGAAACAATTTCGGGCACAATTCTCGCCGCCGACAGCTCTAAAGTCCAAGAGATGAGGGCTGAACAATATTTTCGGTCGCTGTATTACGCAGCAA
ACGTGCTGGCGGCCGTAGGACGTACGATTGAGCCTGCAAGTGATACGGAGTACGGCGCTGCACTGATTTTCATGCTGAGCGGCTTTTTCATCACTGCCAT
TGTTGTGGACCATGTGCAAAAAGGCTTCACTGCGTCTGCTCTTGAGCAGAAAGAATTCtttgcagctcgagctcgtttCCAGCGCTTTCTCAAGCGACAA
AACTCACCGCTTTCCATTCATCAGCGAGTGAACTCGTTTCTGGATTTCTGGTGGTCTGCCCACCGTGGCGCTATTATTGatgagttgctgcaggaccTCC
CTGCTGCCACCAAGCGCGACGTCATACGAAGTATTTGTACACCAGCCATGGATTCATTGGAGTTGCTTTGTGCTTCcacaacagcttcagccCCTGAAGA
ACTAGAACCAGCGAGAACAACAATTCTGGAACAAGTGGAAGAGATTTTCCTGGACAACCTCAAGTTTATACTTTACGGACAGGGCGAGATCATTTATCGC
TGCGGGGACTACGCGTCGGGGCTTTTCTTCCTCCTGGAAGGCAAAGTCTCGGTAATGCTCGATGGTGGAGTGCCACGACACGTCCCGCTTGGCGGGTTTT
TCGGGACTGCGGCACTCCAGTCAATAGCTAGTCATGACAGACGCGAAAGTAGACGGCGCTCTACCACAAAAGCATCAGCGAGTGTTGGATATACCGAACG
TGTGACGGCTGTGAGCGGTTGTATTGTAGTGTGTGTTTCACGAGAACATCTACAAGCGATGCGGAGTATTTTCCCTACTCTGCCAGAAAGTTTACGAACG
TTAGAGCAGCGTTTGCATGATGTACGTGTAGCGCGCTCAGCAGATCTACGGTCATTGCAGCCACGAGTCGCTCTTGGAGCTATCAGTTTGATTAGCCCTA
CTATGCGGCGTGCACTGCGGAAAAAACAATTGGCCGGACTTGTGCAATTATTAGCGAAGAACTTGGAGTGGTGGCAGCGGGGCACAGCAGTGGATCCTGA
CTGGCCGTTTGTGGGCGTGTGGGAGGCGACGATGCTAATAGCGTCAACTGTGCAGGGTGCGCTGGTGATGTTTTATGTATGTTTCGGCGGGAATGACAGC
TCGGGAGGCCGCACATTTGCCGATGCTGTCATGGTTACGTTTGAAGTGCTTTTTGTGCTAGATGCCTACTTGCACTTGCGATTGGGCTTTTATGAGTATG
GCAACAAGATTATGGACCTTGTAGTGATCCAGCGACGCTACTTGCGCTCCGTACACTTTGTTATCGACGTGGCTGCTCTCATGCCTCTTTTTATTGTGAA
TTGGATGCTGCCAACAAGAAAGTTCGAGATCTTGAATATCAACAAAATGCTGAGGTACTTCAAGGCTTCCAGTCAGTTTCGAACGCTTGAGACCAAGTAC
GTGAAGCTCACGATGGAGCTGAGACTCCTCAATCTCGTGTACTATTCGTTTCTTGCCTCGCACATGTTTGGATGTGTCTGGTTCGACTTCGCAGCCCACA
AGTCTGGGGTTCACATTGTGTTGAGTGGCTCTAGCGACAGTTGGCTGCCTTCCTTCGGAGCTTCCCGATGGGGGCCTTACGAATCGCTCGCGTCGGCTGC
ACGGAGTCTTCAGTACCTTGCGTCCTTGTTTTGGTCGTACGGACTTATGTCCAATTCGAGTCCTGGTGAACTACCCAAGACTGTCGGAGAATGTATCTTC
AGTGTGTGCACAATGACGGTGGGGTTCTTCCTGTTCGCCTACGTCGTTGGCCACATTTCGGATGTGATCGAGCTACAAGATTCCGAAAATCGGCACTTTG
TGGCCAAACTGAGCTCTTTGCGGCAGCTTTTGCGTCACTTTGACCTGCCACCGAGTGTCGAGGAGAAGTTTAAGAAgtatttcttcttcaagcgctTCCA
TTCGATCACTCAGGAGCATGTGCTCGAGCGTGTACTGCCGCCTTCGCTGGTAGTCGACATGCGCATGTTCCAGTTGCAACCTATGATCGTGAAGGTGGCA
TTTCTCGTCGGTATGGAGGATTCAGTCACGCGTATGCTCGTGTCGCTTTTCACCCAAGTTCTCTTCGTCAAGGATGAATTTGTATGCCActttggagaag
aaggcagcgagATGTTTTTCATTTATACCGGCGTACTCGACATCTACATTCCGTTTCtagcgtcgtcgtcacctACAACACCAGGTGACCCAGTCGTCTT
CCCCACCTCGGCGACGGGTGCGCGTGTGAGCTTGAGCGGACTACGTAAAGTGAATGAGATCACGGCTGGAAGTTACTTTGGTGAGGCTGCGCTATTCACT
AACACCCCGCGCAATGCGTACGTGAAGGCGAACACGTCTTGCATCCTCTACAAACTCTCTCGACATTCGCTGGAGTTGGTCTTTGTGCGTTATCCCGAAT
GGCAGCAGAAGGTTCTGCGTATTGTCAAgatccagcaacagcagcagcgacttcagcGTCTCGCCTATGAAGCGCAGGCTCCCGATACTGGGGGaggaac
tcgtcgtcgtgggATTCAGCGCACAGTGTCACGCATGGATTTTGTGAACGCGCTGGCAGAGAATATCGAGCAATTGCTTCTTAGCCACCGAAAAGGAACG
AATGCGTCGAACGACGGTCCTCTCCGGTTAAGGTCATGGGCGATTCAGCAGTGGCGAAAACTCTGTGCAACATCCCTGGTTAAGCGCTGGATGATTCCAG
CACTACGTTCGCTGCAGACTGTTGGAAAGCAGGTAGCTCTCGGAGCGGAGATCCAGAGTCCATTTTACCTCCAGTGGATGCGCTTGGTGTCTATTTGCAC
AGTGTACGTGGCTGTGATGGTCCCCTATCGTCTTACCTACGACTCGCTCGACCGATGGAACATTATTCCTGTGTGTCTTCGAGTGTTCGAAGCTCTGTGC
GAGGTGGTGTTTTGGGTCGACATTTGGTTCCAATTCCATACGCGCACGAACCAAGGAGCTATGGAGTTGTATGAGCAGGACCAACTAGTAGGATACAAAC
GCGAGCGACTTGCTCTTGACCTCGCCGCCACCTTCCCCCTGGATCACTTTGTGACGACCTTTTCGAGTGGATCGAGCCGATTGTTGTTGTCCAAATGGTT
GCGCCTCAGTCGCTGTCTGAAAGTGGCAAATCTCGTGTACTACCGGAACGAAATTACGCGCCGCAGCGTGTCGTATGAGGTGAATCGTGCACAGACGCTT
TGGCTGTTGTATCTGCTGGCAATGTTTTGGACATCCTGTGCCTATTTTGCAGTATCGATATACGATGGCTTCGGTACCGAGTGGCAGAACTGGCTGCCTT
CGTCGGTGCTTGATTCAGAGGATCCATCTCCAGAGCTGTTAATGTTGAGACTTTTCCGAGGTTTAGCCTTTGCAGTCACTGCATTCGTGAAGAAAAGCAG
GACGTTTGTACCCACGTCGCAACTCAACTTCGCGTTTAGCATTGTCATCTCGTTTGTTGGCCAGCTTATCATGGCTCTCATGATCGCCGAAATGGCCAAC
GTCTTTTTGCTGTACATCGATAACGAGGTACAGTTCCGCAAGAACCACCTCATTGTCGAGCGCTCCCTTGCAAGGTGGAAGGTCAGCACGGCACTAAAGC
GACGTGCTGATAACTTCCTCACATCCTGGTGGTCCTCCCATGCTGGCGTCGACTACCAATCGATATTTGAAGACTTCCCTGCTAGTGTACGCACAGAGGG
TATAATGGCCATTGCAAAGCAGCCGCTAAGTTTGTTCGTCTACCGCGTGTTTCGGCCGCTCCTACGTGACGGACATCAAGGCGGAGTTGGAGGCCCAAAT
AACGGAGCCGAGGGAGGTGAAAAGCGTGAAAATCCCAGCTACGACGCTACTTTTCATCTCGGAAATCTCACATACGCTATTGCCAAGTGTCTGCGGTTTG
AAGGATATCCACGAGGTGAAAACATTATTGTGGAAGGCAGCGTGTGCAAGGCCATGTATTTTATTGTTCGAGGCTACCTATTGTCTAAGAGCATGTCTAA
TTCGGAGATGTACCCGGTTAGCCGCTTTCGAGGTGGTGATTACTTCGGTGAGACTGGCCTGCTTGGCCATTCCGTGAGTCTCATGACTGTGACTACCATC
CGCGCCTGCGACTTGTTCGTATTGAACTCGGAGCACCTACTTCAGGTACTTGAATCACACTCGTATTTCAGTTTGGTGCTGGCTACTGCACAACTAGCTG
TTAgtcagaagaagacgaccGCTGAGTTTGTGGCGGACTGGTTTAGTAGcaacgatgacgacgaggacatggcgagcaatgacagcaacgacgacgacag
cgatgataatgatgatgatgacagtgatgatgaaggtgaAATGGACCAAGGATCTCTCATGACAAGCAAAACTGACAGCATGAAGAACGAAGATGTAAAA
CTAAGACGCGGAAGTCAACAACTAAAGCGAACACTATGCGGAGCGTCCCCGGAGACCATGGAAACGTGGGAGGAATCGTTCGCGCTCTTTATGGAGATGC
TTGTCCCTAAGGGCAGTATGGGCTTCACTGTAGCTGCAAAAACTGAAGCTCAAGCCTAACAGTTTGCAGGAGTATTAGGAACAAATTGAATTCAACTAAA
GTTTTGATACTTCTGAAGTAAGTGGCACCGCTCGTGTGCATGAATAAATAGCTGTCGTCATATCCGAGCAGGTTCACTTTTATTCGTCAACTTCCATCAT
ACCTTCGAGGCGCATGAGGATCTTGGTGAGGTTGTTTAGCTTTGCCTCGAGCCGCTGTTCTGTTTCCATCAGCCGTTCCTGGAAAGTCTCCTGCATATCG
AGCAaccgaagcagcagctcattaTCTGGCATAATTAGAGGAGAAGAGTTGCTGGGCTGTGGCTCCCTTAATCCTGCCGCATTAGCACTAGGCCCGCTTT
GTTGTTGGGGGGTATCGGAGATTGCCGTTGAATCCGGCTTTGAATCAGCAGAGGCACCAACCAAAGTGGTCAACTGCCGCGTTGGTACTGCTGAGATCGA
ATGACGGTGCCCGAAGCTGTCGGTACGCGAGGCTTTGCTTTGCAAGAGCAGTTCTGTTGGTGACGGAACAACAGCGGAGCCTGATCGACGtcttgaagtt
gatggcgaGCGGTTGTGGTGGAGACCGACACCAGGCACAACCACCTGGTTCATGAATGCTCGGTTTTGTAGAACTTCGAGGTCGTTGCGAAACTTGGCAA
GCTCGTCATCCTCGAGCATACCGCTGTTATCCGTGTCGTACACGttgatgacgtcgtcgataTCGAGATGGATCCCCTCCGTGACTGCGTGGAAGCGCTC
CAGAATGGCCTCGATCTCGTTGCGGCAGATCATGCGTTTTCCCTTGAGGAAGTCGACGTTGCTCTTCATGGTTTGATGCATGACAGACTTCATGACTTTT
TGGAAGTTTGTACCGATGACCGTGATAGGCAGCGCGAGCACAAGCATACCCGTGAGAACGGTGCAACACCCTACGACCTTGCCTGCCCAAGTAACTGGTG
TCATGTCTCCGTAGCCGACGGTGGACATTGTCACGATGCACCACCAGAAGGACGTCGCGATGCCTTGGTATGGATTTGGGTCCACGCACACACAGGCGTC
AGACGCCGACACAGCCGCtaccgctgcagctgcggaTACGGAATACTCTACATCGGTGATATTCACGGTCCCAGACTCAACGTCACACTGCCCCATCCAG
CCACCTTGACGGCAACCATCATCTGTAAGCTCAGCAAAATAAATGGCCGACGAGAAAATAATCATGGCGATAGACATCAGGAATATTAGCATCGTCAGGG
GCTTGATACTGATAGAGATCGCCTGTGTGAAAACCTGAATCGCTGACGAGTAGCGTGACATCTTCAGGACACGCGCCACACGCGTGAGCCGCACTATTCT
GATGGCACCAAAGGACCCAGCATTGTCCACAGCTAAAAGCGACTCCATGTAGTATGGGAAGACCGCTGCAAAATCTACCCAGTTCGAGTAGTCTACAGTA
GGAAGTTGTGTCAGTACAAGCGTGTACGCATCCGTAGCAAACATCGCAAAAACTAAATACGTACCACGGAGGAAGACAAATTTGCTCGGACACACAAGCA
GACGAGCAACAAGTTCGAAGGAGAACACACCGGCGCAGATTGCTTCCATGTGAGTGAGTACTGTCATGTACGGGACGAAAGCTGCCTCCGTTTCAGCAAC
GAATACGAATGTGGAAAGGATGATAAATCCATAAATGCCCAACGAGAAGTAGTAGGCCGCCACTGACGACTGTGGGTCCTCGAAAAATAACCAGGCCATC
TGCATGTAGCCCACATGCTCTTCAATGTCATCTGCCAGCGATTCCACCTCAGTTCTAGACCCTTGTTGTATAAGAGTTCCTTTCACGTCACTGGCCACGC
GAGGAGTCGGCAATTGGAGGCTACTATCCGCTGTTGTCGATGCCGAGTACTCCTCTGGTGTCGGCGCCACAGTTAAGGACCGTCTACTGCGTAGGCTTCG
CTGGCTCGCTTGCTTCTTACCGGTATCTGTCTTCGGGCGTGAGAACGATGGAAAATGGGCTTGAACATGGAATAGTCTCGAGCTGTGGAGTGCCGACCTG
CGTTTGGCCTCGCGCTCAATCACCTTCGAAAGCTTCAGAGCTGTATCTGAAAGCTCCATGGGGCCTCCAGAGCCTCGCATGAAGATTTACTTCCAGACGC
TAAACACCGGAGAAAGAGCACGGGTTCTCACTCACAGCCAACGACAACTGCAAGCGAGACCAGAGCACTTCACACGCAACTAGCACAACACCGACCAAGG
CCTTTCACAAAAAACATGGTAAAGCAGTTAGACACCTAAAAATATGGCGATGGTTTCGTACTGTAGCAGCGTCGTCAGTATTATTGATGCAGGCGGAGCA
ACCGTTATCCATGCAGTCGATAGCTCAGCCGTTATACGCCACCGAGCTCAGGTCCCTCACTTCCCAGTTATAACAAGGAATTGCAGTCTATTCATGAAGT
GATCGAAATGCTCATGCGGATGAGGGCACCCCAGGACTGGAGTTTcaatcagcagcagacgtTTCCTCTGCTATTGGtactgctcctgcagctggcaCCG
CCTCACTATTGTCAGCTTGAACAGCAATTTCTGCACGTGCTGCCTTTGCCAACTCGCGCCTGCCAGCACGGTCCGTGCGAgtggcttcctcttctttctc
cttTTTCCATTCCAGATACGGCTTCGCAACGTAGTCAAACGGCAGCACCTCCATAGTGTGCAGCCACTTTGCGTATGCGCGGGTGCGCTCTTCGTGTTTC
ATGATGTGGTCATAGATAAAGTCACGCTTGAATTGCtcgaccgcagcagcaacagcaggcTCCTTCAGATCAAGCGGCGGGTGCGATGTCTGGATCGAAT
CAGCCATTTTCATGTTGTACACCTCGAAGTGAGCTTGTGCCAGGTACAATCCCACACTAGGTGCCTTTGGCAAGTCCATCTTCGTTAGCCCCATGGCACG
CTCGATTGTTGAGGGGTCAGTAATACCCGAGACGATCTCCACCGCAGTGCCGATCATCTTGCGGATGTggtgcagcaagaagctctGTCCAACCACACGC
AGTCGCACCCACTCCATGTCATTCTGCTCGAACGGGTGCTCAGCCTCGAACGAAATGATGAAGCGATTTGCCTGAGGGTTGGTTGGCTCCATCTTGGACG
TAAAGTTGTGGAAGTTGTGAGTGCCCACATactgcttcaacgtggcGTTGAGCTGTTCCAAAGTGTCGTTACTCAGTCGGAATGCCTTGTGcgcctccag
cgtcgtgcTGTCAATCACCATGTTGTCGTCAAAGCCCTCCTCCGAGTCGCGCAGATCCGATggccacggcgtcgctgcttccTCTCCCTTGTCTCCAGCA
TCTGTCGAGGCTGTAAGACGAGCACGTTTGCCGAAGATGAACGTGGGCGCGAGGTACTCGTAGGTACGCTGGTCGCACGACATTTTGGCGTTGAAGTTCT
TGGTGACTGTCACCATCTGCATTACGCGAATGTCCTCGGGCAGCGCGGCGTTCAccttggagatgaaggccgGAACGTCGTCGCCCACGTGGAGTTTGGC
TGTCAGCAATTGGCCCGCGGCGTGGACGCCCTTGTCTGTACGAGCGGCGCGACTCCAGCCGATCTTCTGCAGGAACCCGTAGTTGGACTCGGCGATGCCA
CCAGCCTCGAACAGCgcgcgctccagctccgcttCGATGGTCTTCACGCCCTCGTTCATTTGCATGCCGCTGTAGTTTTTGCCGCAGAAGGCCACCCACA
GGCCGTAGCGGCGCTTGggcggcagcgacgccgccACAGCTGCAGATTCGTCAGGGGACgggcgctggcgctgcgccGCGTAGGAGCCAGGGTGGACGGC
CTCGGAGCGGTCAGCGCGGCGGTCCGTCTCCTtatcctgctgctgctgctggtcgtcatCCTGCTGGCCGTCGCGACGCGCctgcttgttcttgcgcCGC
ACGGCCCAGTGGGTCTTCTTGCGCTTACCTGCCATGGCGCTCCAAAGTCGCTAATAGCTGGAGCCAAGTCGCAACCTGAAACGGTACCTTCGAAATGGTA
CCATGACCACCACTCTTATTGATGTACGGCACACCAGCGGGTCGGACGGCTCAGTCGCCGATTATTCATCACCTCCAGAAATGGTGTCACTGCGAAGTCT
CCAGCCGCTGCGTCGCGCGGCGCAGCTGGCCGTGCGCTCGTCCGGCAGTCGCTTGGCACCGCTGCAGTCGTTGACTGCGCCGACGCGCGCCTTCTCTCAG
GCCCACACGCCGACGCAGAGTGTGGACCCCAAGGACATTTTGCGGCCGGACGTGCCCAAGGAGACCAAGCcgcagctgtcgctggagcaggaactGCCGG
GGCTGCCCCAGCTCAAGCCCGCAAGCCAGCTCAAGCCCCCGCAGACGGAGATCACCGTACTACCCTCGGGGCTGCGCGTCATCTCGCAGGAGACCTATGG
CCAGGCCGCCACGCTCGGCATCTTTATCGACGCCGGCAGCCgcttcgaggacgacgacagcgtggGCGTGAGCCACTTGCTGGAGCACTTGGGCTTCAag
agcaccacgtcgcgCTCCCATGCGCAGCTGGTGCACGAGATCGAGGACATTGGCGCGCtcacgacgtcttcgtgcGGCCGCGAGCAGATCATCTACACCA
TTGACCTGCTGCGTGACAATGTGGAGAAGggcctggagctgctggccgacgcCATCCTCAACGTAGATCTGGTGccggaggagatggaggGCATCAAGGC
CATCATGCGCATCCAGACGGAGGATCTGATGGAGAACCCACcggcgatgctgcaggagttcatccacgctgctgcttaCGGCACGGACACGCCGCTCGGA
CGACCGCTGCAGTGCCCACTAGACAAGATCGACGCGTTGACAGtggagaaggtcaagaagTTCCGTGCTGAGCACTTTGTCGCTCAGAAGATGGTTCTTG
CTGGCTCCGGTGTCGATCACGCTCGACTGGTGAAGCACGCGGAGAAGTTTTTTGCGAACGTGCCTGTGGCCCCAGCTGACACGCCGATGGCGACGCCGTC
GAACCCTGAAACGTTGGAGCCGGTGATCTACACGGGAGGACTGTACCCGCTCCCGAACCCGGAGTCGGAGTTTTCGTACGCCGCGCTGGCGTTCCCTACG
GGTGGCTGGCACGACGATGACCTTGTGCCTATTTGTGTGCTGCACACGCTTCTGGGCGGTGGCGACAGCTTCTCTGCTGGTGGTCCAGGCAAGGGCATGT
ACTCGCGGTTGTACACGAGCGTTTTGAACCGCTTCTACTGGGTCGAGTCTGCCTTCGCGTTCTCGTCCATCCACGCGGACGTGGGTCTCCTGGGCATATA
TGGTGCTTGCATCCCGTCGCACACCAGCAACCTCGTGGCACTGTTGTGCAACCAGATGCTCAGCGTCGCCAACCGACCCGTGGATGCCATTGAGCTTGCT
CGTGCTAAGAATCAGCTCAAGTCGTCTGTGCTCATGAACCTCGAGTCCCGCATGATCCTGTACGAAGACATTGGTCGCCAGCTGCTTACGTACGGCGAGC
GTGAGACGCCCGAGTCTGTGTGCGCTAAGATCGACCAGGTCACGGCCGCAGACATCCAGCGAGTCGTGAAGGAGGCCTTGCAGAACCCGCCTAGCCTCGT
CTACTCGGGAGACATCCCCCGATTCCCGCAGTATCAGCAGGTCATTGCCGGTATTAAGGAAGGACTGACCGAGTAAGTGTTATCCATCTAGAAAATCAGT
CAGGTTGGACTGCGAGGTCTTCACCCGTCGATCTCGGCGAGATCACTGATAGCAAGAGGTGCCCGTAGCACAGCCCAGATAAGGAGAGAAAAAGCAATAG
AAAAAGGCAAGGCAAAAGCGGTATTGTGTTCGAGACAAACGTTTCATGCCAATCCCCATACTGCGACCAATGTGCGATGGCAAGCGTCGTTGGTTGGGAC
TCTCAACGCGCAAGTACTTACCAATGGGATAACTAACGGCGCTTGAGTGCGGcttcctcctgcagcaagcgGAAGCCTCGAAGGTACTGTTGGCATTGCG
CGGCGGTGTCTGTCTGCAGGTCCAAAGTACGGCAAGGGTGCACACACACGAGCGAGAAGCAACGAGCTGGTGCATCAGGTCGCTGACGAGCGAAGGTCTC
AGTAGTAGCGCCGGGCAACACCTCCACCAGGTCGCACGTGTCGACTTTGGCGTCAGGTTTTGGTTGCATCAGCGAGCCGTGGGTGACCGACGTGGCAGGT
GAGCGCCACGACAGCCAGTGGCACTGGGCATCAGCATACACGACACGCTGGTGAGGCACACCGCGCGCCCCGAACTTTGTCACTACAATGCCAATCTCAA
GCTGCCGCTTGAATTGAGCAAGAAACTCCTGTTCCTTTGCTtgaactgctgcacgcgTTCGACTGGTGCTCTCCAACTCGTCAATCGCGATCTGAAGTCG
ATTCTTCTCCGTGCGTTCGTCCTCACAACgctgctcgagctcgcgtATCTGGCGCTTCAGATCGTTTTGTGCGgtttgtgcttcttgctcaacCTTTTTT
CGGACGACCTCGAGCTCAGCACTAAACTCACCACGCATGCTGCGCTCGCGGTTCTGCGCTACTCGTAATTCCTCGTGCAGCGAGGCTAGCAGCTGCTTGC
TCGTAGTATTCACTAGATCCAAGGCGCGAACTTGTTCCTGCAACTGCTGTAGTTGTTGCTCATGGCACGACAATTCCGCCAGCAACTCATCTCGGTGTTG
GTTTAAGTCGGTGTTAGTATCCTTCAGCCGCTCCTGTATTggccgagttgctgctgcgattACTGGTACATTCGTGTCTGCTTGAGGCAGCAACACCGGT
GTCTGCTGGATTGATAGATCTACCGTAGGAATCTCAGCGCTAGTACGGCTTTCGTCTGTTGGTGGGGCCACAGTAACGCGCGAATTGGCAACCTCAAGCG
CAGCCTGGAGCTCTCGCACCTGCTGGGTCTTAGCTGCATGGGCCGTccgaagcgcagcaagtACAACCTCGACTGCGCGATGGGCTCGTTGCGCATCGAC
CAGCCGGTCATGCAATTCGTCTACTTGATTCTGCGTATCTCGGTGCTCctcttgcagctcctgcCACTGCAGCGCTAGCATTTCCTTCTCGTGCCGAAGA
TGGTTCACTTGTTCTCGGCTTTCTTCCGCTGCAGTGGTCTGCTCTGCAAGCTGGGCCTGGAGATCTCTCAACGTCTGCTCAAGCTCCtcttgatggcgtt
gcaACTGTACCTGCTCAATTTTCACCGTTTCCAGCTCGGCTTGCTTGGACGCTGACGCCCGCTTGTGTCGCAGAAGCAGTTTATTGACAGCTACCATGTC
ATCACGTTCTCGCTGCACTTTGCGGGTCTCTTGTAGCAGGGTCTCCAGTTGACGAGCAGCTACATCTTGCTCCCTCTTcactgcttcttcgcgttcatgC
TGCACTGCACCCAGTTGCTCTCTCACAGAGTTTAATTGCTGACTCACTTCAAGATACTCTGTCTTTAAGTTATTCACCAACGTGTCCGAGCCATCTGCGT
CTGAATTTGTAGTCTCAGGGAGTTGGAGACAATCGCTTTTGAGTTCCAGGCCAGATTGGCTATTGCGGCGAGAGCTAGACTTCCCTGGCCCCATCGATAG
ACTGCTTCTGCGCCGAGTCTGTCGCGTCGGAGCAAGACTTCCTAGACTCTTTGATCGCTCTTCGAGACCCGAGTTCGTCAGCCCAGAACTGATGTCGGCC
AGTGTCAGAGTCAGCGCCGGCTTCGCGTCGCGCATCCTGTGATAGAACAGCAGAACAATCGCGTAGCATTACAACGTGGCCCTAGCAGAATATCGAAATG
GCATGCAGCACCATACTCACATCTGGAGGATATCAGCGTAGGCGATGTTAGCAACGTCGTTCCCGTTTACCATTCGCACACGAAGTTTGTCGACAATGAT
ACTAGAGTAGTCGCCTGCTGCACGGCAGTGTGCATTGTAGTCTGCTGCAAGCCCCGCAGGTGCTACATCCCGGACGACGCAAGCGTAACTTTCGGCAGGA
ACCAGACTAAACTTGCTACTCTTCGACGCAGGATGGAAGCCAAGACCCACAGGTTTGCTGTCATCGAAGAACACGCTGAACTCCTTCTCCCACCGACGAG
GATATTCACTTCGCTTTGCACGAAAAGCGGCTACCAAAAGTTCATCACGCGCTCGCTCTGCACGAGATCGCTGTACTTCAGCAGCCTGATCCTCGTCTGA
ATCGTGGTTACTCGGAGGCACAGGTGCAGGTTCCTCACTCCACGGCGGACTGCAGAATTTAAGCACCATAATGTCCTCGTTGCTGATGCAAGTCAGGTGT
CAACGGATTGTGAACTACCACACAGTTGGCGTGCTGCAAGTGAACGAAAGGTTAGCATAACCGCCGAGTCCTAAGCCTCCAGTTATAGACTGGCATGATC
TCACAACCAGAATATCACCTAACGGCGCCACGGCCTCCAGCAAAAAATAACATGTTTAAGTTAGTGAGCGCGGTTACTTGACCTGATGAAAAGAAAGAGA
GTATCAGCTTCCGCTTCACGCTTCAAGTTGTGTCTTCTGTTTCATTTCACAGATTCTTCCAGTTGATTCCATGGCACTTACAGCAGCGGGAGGCAGCCGG
GCACGCGACACGATGCACGAGCAGAGCATGTAGGTGCATGCGCCCGCACAAGCGCCCCCCAGAGCTTACACGCGCCGCACCTGTTCGCATCATGCGTCGC
TTTGTCTGCCATGCTCAAGCGATGGGCTTTCACTTTATCCACAAAAGTGCGCGTAGATACACATAGTGGGTTGGGACACCCGCTGGCGCTACACGTCGAT
AAATGCTGCAACCCACGGAGCATCGACTGCATctgcgcagctccaggagtcgacgccgctgccgtcTTGGCAGGAGGCATCTTCTTGGCATCGGAGACTT
CTCCCACTGATGTGGGGCTCCGTGGTTCACGACGTAGACGCTTTGCctgtggtggagctggtacCTGGCACCTGAAAGAcgacactgctgctgatggtga
ACCTCCTGCGGCGGAAGCCTCGCctaaagaagaagatgacgcgAAAGACACTCGCGGCGCTGCAAATGCTACGCGAGACGGCGTCCTGACGGACTGCGAC
GAGAGCGAGTCGCTGTGGCTGCGCTTGCGAGGGAGTCCATGGACGGAGCTAGCGACGATCTGCGAGCGCGAGATGGAGTAGGACGGCGGCAGCGGACTCG
ACAATGACGGAAACGGGTGGGCATCGAGGGCAGACACAGAGCCAAATGCGTCTCGATCAATCCCGCCGTTCGTAGGAAGGCTCTGCACAGTGGAGACAAG
GAAGAAACGAGAGTGAGAAGGACCGTtctacaagtacatgtagcaggTCCAAAGCTGCGACTATCGAGATAGGGGACGCACCATTTCAGCTCCATCGGCC
ACAAGGAGATGATgcgccagcttcacgatGCGGCAGATTACACGCGTCTAgacacggagaagaagacggcgaggaagacgaagaacggcggaggagaaga
cgacgtcgagcagGTGGTGTACTGTGTTGAACTATTGAACTGCGCCTCTGAGACTTGTGCACAAGCACCATCACTCAGAGAGGGCTAGGGCTACTGTGTT
CCTCGCACAGTTCTTGTGGC