Description :
From Genome Similarity Track
Location :
Scaffold_424:5599- 8195
Transcript NameFunction/comments
Aphin_H310_10359predicted protein

Sequence
2596 bases(100 bases per row)
ACCATCTGCGGCACCTGCCGCGGCAACTGCGACGACAGTCACCTGCATGTTGTCCCAAATGACCGACGAAGAAATCCAGGCGCATATTGATTCGCTCCAG
CAAAACCACTGTGCCTCCATGACGGTGGTCCAGCTGAAGAAGCGGTTAGACCCGATCCTGAAAAACATGATGGAGCACAAGTTCGGGTGGGTGTTTAGCA
CCCCCGTGGACCCCGTCGCTCTGGGCATTCCCGACTATTTCAACGTGATCAAACGCCCGATGGACTTTGGCACAATCCGAAAAAAGCTCGAGAGCAACTA
TTACAAGCACATTTACCCGTTTGCAGCCGACGTTCGGCTCACGTTCCGCAATGCCCTCACGTTCAACAACGAGGGCGAAGAAGTGTATTCGCTTGCGAGT
GACATGCTCAAAGACTTCAACTGCGAAATGGCCAAGCTTGAGGCGGAAATCAACGTCGAGGAGGTGATGGCGCGCGAGAAGGATGGTGCGTGCAGGCTGT
GTGGCCTCGAGTCGCTCGTGTTCGAACCTGCCATCTTGTACTGCAATGGCGAGTGCAACACAAAAATCCGTCGCAACAACTACTACTTTTGCTCGGCCGA
CAACAAGTTCCATTGTTGCGTGACGTGCCATCCGAACCTTCCCGAGAGCATCCCCAACGCGGACGGCGTGCCGTACGTCAAAGCGGAACTGACGCGAAAG
AAGAATGACGAGGTCCATGAAGAGCCATGGGTGTGCTGCGATAAGTGCAACCAGTGGGTTCACCAGATATGCGGCTTGTTCAACATGAAGAACGACAAGA
CGGAGAAGGACTTGAAGGCTGACAAGGAGAAGGGTCAGGACTTTGTGTGCCCGTCGTGCGTGTTGAAATCCGGTCGGAAGGGGGTCGAGAAAAAGGTGTG
GACAGCGAAATCGCTGCCTCGGTCCAAGCTGAGCGACTACTTGGAGCGCCGTGTGGCCAAAGTGATGGAAGCGGAGATCACGGCCGAGATGCGGAAGGAA
GTCCCGAGCACCGACAAACTCATCATTCGTCAGGTCAGCAACATCGAGAAAACGCTGATGGTCCGCGACAAAATGTACCAGCGCTACAAGGACGCCAAGT
ACCCGTCCGAGCACCGGTTCAAGTCGAAATGTTTGTGCATGTTCCAAGAAATTCACGGTGTCAGCGTCCTTCTCTTTGGCATGTACGTGCACGAGTTCGA
CCAGCAGGAAGCCAAATGCAACTCGCGTCGAGTGTACGTGAGCTACTTGGACTCGGTCAACTACTTGGAGCCTGCGTACTTGCGGACCAAGTTGTACCAC
GAGATCCTGATCGGGTACCTGGACTATGTCAAGCAAAGGGGCTTCCACACGGCGCATATTTGGGCATGTCCGCCGCTCAAGGGCGACGACTACATATTGT
ACTGCCACCCAGAGACTCAGAAAACCCCCAAGAGCGATCGGCTGCGGCAATGGTACATTCAAATGCTTATGAGGGCGAAAGAGGAAGGGATTGTCGTGGA
CATTAACAACATTTACGACGAGTACTGGTCGACGGCGCAGGCATCGCCGATGGAACTACCGTATTTTGAAGGGGATTACTGGGTCGGGTTGGCCGAAGAG
CTGATTGAGAAGCTCGACGAAGACGACAAGACAAACAAGAAGAAGAAAGATCAGAAGAGCAAAAAGCCCAAGCAGCAGAGCAAGGACGCTGCGACAGAGG
TGGAGTTTCAGGACCCGCTGATGAAAAAGCTCGGCGAGCATATTTACCCGATGAAGGACGACTTTTTGGTGGTCAAGTTTTTCCCGTCGTGCTCTCAGTG
CAAAGTTATGATCGGTCAAGGCACAATCTGGAAAGAAAGCAAGACGTGCCTGTGCGACGGGTGTTACCAGAGCCAGATCCTGAACCAGGCGAAGAAGGAA
ACGCCGCCGTACATCCCGATCGTGCTCACGCTCAAGGGCAAATGCACCGACCCGGACGACATTGTCGAAAGCGAAGTGTTCGACACACGGCAAGCATTCC
TGTCGCTGTGCCAGACCAACCATTACCAGTTTGACGAGCTACGGCGGGCCAAGCACACGTCCATGATGACGCTATTCAATCTGAGCCAGCTCACCAACAG
CTACGTGTACAGTTGCAACGTGTGCAAGGCAGAAATCACGAGCGGCACGCGGTGGCACTGCAACACGTGCGTCGACTACGACGTGTGTGCGTCGTGCTAC
GACAAGAAAGTCAATGTCCACGTGCACATTTTGGAAGCGGTCGGGACGATCCCGGACGAAGCCAAGAAGCAGTTGGAGGAAAAGAAGAAGAACATTGCGC
TGACCATGCAACTCCTCGTGCACGCGAGTAGCTGCGAGGAAGGCGGGTGTTCCTCGACCAACTGCGACAGGATGAAGGTGCTCATACGCCATGGCTCCCA
GTGCAAGCTCCGGGCCACAGGCGGATGCAACACGTGCCGACGTATCTGGACGCTGCTGCAGATCCACGCGCGTCAATGCCGCACGACCGAGTGCCGCGTC
CTCCGGTGTAATGACCTGCGCGAGCACTTGCGGAAACTGGCGCTGCAGCAGCAGCTCATGGACGACCGACGGCGAGCCGCTGTCACGGAACAGTAC